Abstract
The human genome contains more than 4.5 million inserts derived from transposable elements (TEs), the result of recurrent waves of invasion and internal propagation throughout evolution. For new TE copies to be inherited, they must become integrated in the genome of the germline or pre-implantation embryo, which requires that their source TE be expressed at these stages. Accordingly, many TEs harbor DNA binding sites for the pluripotency factors OCT4, NANOG, SOX2, and KLFs and are transiently expressed during embryonic genome activation. Here, we describe how many primate-restricted TEs have additional binding sites for lineage-specific transcription factors driving their expression during human gastrulation and later steps of fetal development. These TE integrants serve as lineage-specific enhancers fostering the transcription, amongst other targets, of KRAB-zinc finger proteins (KZFPs) of comparable evolutionary age, which in turn corral the activity of TE-embedded regulatory sequences in a similarly lineage-restricted fashion. Thus, TEs and their KZFP controllers play broad roles in shaping transcriptional networks during early human development.
Similar content being viewed by others
Introduction
The human genome hosts some 4.5 million sequence inserts readily recognizable as derived from transposable elements (TEs). Most are retroelements, whether ERVs (endogenous retroviruses), LINEs (long interspersed nuclear elements), SINEs (short interspersed nuclear elements, which include primate-specific Alu repeats) or SVAs (SINE-VNTR-Alu, composites of an ERV and Alu, restricted to hominids), which replicate through a copy-and-paste mechanism with reverse transcription of an RNA intermediate followed by insertion of its DNA copy. TEs are increasingly recognized as major drivers of genome evolution owing to their recombinogenic and regulatory potential, even though most are unable to spread further due to inactivating mutations1,2.
TEs are tightly controlled by epigenetic silencing mechanisms, yet many are expressed when these mechanisms are put on hold in the context of genome reprograming during gametogenesis or in pre-implantation embryos, when transposition results in inheritable new integrants. Correspondingly, thousands of TEs, albeit mostly primate-restricted ERVs (HERV9, HERVK, HERVL, HERVH), SVAs, Alus, and young LINE-1s, display marks of open chromatin and are transcribed during embryonic genome activation (EGA)3,4,5,6. The same subset of TEs is enriched in acetylated histone, a hallmark of enhancers, in human embryonic stem cells (hESCs) derived from the pre-implantation embryo7,8,9, where many are bound and controlled by pluripotency transcription factors (TFs)7,9,10,11,12,13. This broad induction of transcriptionally active TE loci likely contributes to the efficiency of EGA, and their cis-regulatory influences shape the gene regulatory landscape of the pre-implantation embryo. In a remarkable regulatory feedback loop, the pluripotency factor-mediated activation of primate-restricted TE-embedded enhancers leads to the expression of evolutionary contemporaneous Krüppel-associated box (KRAB)-containing zinc finger proteins (KZFPs), which act as sequence-specific repressors of these EGA-induced TEs9,14.
KZFP-induced heterochromatin formation and DNA methylation are often viewed as responsible for maintaining TE-embedded regulatory sequences in a repressed state at later stages of development and in adult tissues15,16,17,18. However, it has become established that TE-embedded regulatory sequences (TEeRS) influence multiple aspects of human or mouse biology, and it is increasingly recognized that KZFPs exert profound influences on their actions2,16,19,20,21,22,23,24. Here, we report that many TEeRS induced during EGA are re-expressed during gastrulation and exhibit an open chromatin in fetal tissues, with a high degree of lineage specificity reflecting their activation no longer by pluripotency factors but by cell-type-restricted TFs. We also determine that many of these TE-derived enhancers are enriched near KZFP genes, the secondary stimulation of which is responsible for lineage-specific heterochromatin formation during germ layer formation. We thus conclude that evolutionary recent TEs and their KZFP controllers strongly influence and thereby confer a high degree of species specificity to the conduct of human gastrulation and fetal development.
Results
Cell-type-specific expression of primate-restricted TEs during human gastrulation
To examine the transcriptional state of TEs in the immediate post-implantation period, we analyzed single-cell transcriptome data from a gastrulating human embryo25. Gene expression patterns allowed the grouping of cells in clusters corresponding to epiblast, primitive streak, primordial germ cells (PGCs), ectoderm, to nascent, emergent, advanced, yolk sac and axial mesoderm, to endoderm and to early hematopoietic compartment (Fig. 1a, Fig. S1a). Overall, we could detect transcripts emanating from more than 100,000 TE loci, with a marked relative overrepresentation of primate-specific integrants (Fig. 1b, Fig. S1b). Many of these evolutionary recent TEs belong to the SVA, HERVK, HERVH, L1PA3, L1PA2, and L1Hs subgroups (Fig. 1c), previously found to be transcribed during EGA3,9. However, these EGA-induced subfamilies were more highly expressed in the primitive streak compared to the epiblast, consistent with de novo transcription, with some displaying further cell-specific patterns of expression (Fig. 1d, Fig. S1c, d). For instance, HERVH expression was broad but highest in PGC and axial mesoderm and low in hematogenic derivatives, whereas HERVK transcripts were most abundant in PGCs, endodermal cells, and blood progenitors (Fig. 1d, Fig. S1c, d). Interestingly, the evolutionary young LTR5Hs-HERVK were expressed in both PGCs and endodermal cells, while the more ancient LTR5B-HERVK were detected only in the latter tissue (Fig. 1d, Fig. S1c, d). Moreover, HERVK11 and HERVS71/HERVK22 transcripts were abundant in the primitive streak and nascent mesoderm for the former and in definitive endoderm for the latter, but were not present in epiblast cells or previously detected during EGA (Fig. 1d, Fig. S1c, d). HERVIP10FH and HERV17 integrants were similarly de novo expressed in PGCs (Fig. 1d, Fig. S1c, d).
Evolutionarily recent TEs exert cell type-specific cis-regulatory influences during human development
Having documented the germ layer-specific expression of EGA-induced and several other TE subfamilies during human gastrulation, we next asked whether their stage- or lineage-restricted expression correlated with cell type-specific chromatin accessibility during human development. For this, we examined several in vivo and in vitro pre- and early post-implantation model systems. First, we re-analyzed chromatin accessibility dataset obtained from pre-implantation morula and blastocyst4 and their respective in vitro derivatives naïve and primed human embryonic stem cells (hESC)9, observing that many TEs expressed in specific cells of the gastrula exhibited some level of chromatin accessibility in the pre-implantation embryo and in hESC (Fig. 2a). Interestingly, most accessible subfamilies also have enhancer activity when tested in hESC with an episomal reporter assay13 (Supplementary Table 1). Next, we turned to in vitro differentiated hESC derivatives. We re-analyzed single-cell RNA-seq datasets generated from hESC-derived embryoid bodies (EBs) and chromatin accessibility studies performed in their purified primordial germ cells (PGCs) derivatives26 (Fig. S2a), as well as transcriptome and chromatin data from hESC-derived endodermal cells27. In addition, we experimentally profiled chromatin accessibility and RNA expression at the single nucleus level in gastruloid, a self-organizing elongated embryoid body recently proposed as an in vitro model to study some aspects of human gastrulation28 (Fig. S2e–j). We found that in all these systems several TE subfamilies displayed cell-specific expression and chromatin accessibility patterns that matched their expression in the gastrula. For instance, the chromatin of LTR5Hs and HERV17 integrants expressed in PGCs was opened in EB-derived PGCs (Fig. 2b, S2b, d); as well, RNA levels and chromatin accessibility were matched for HERVH integrants in the axial mesoderm and in gastruloid-derived axial cells (Fig. 2b, S2k, l); finally, the endoderm-expressed LTR5B/Hs-HERVK, LTR6B-HERVS71, and HERVH displayed an open chromatin in hESC-derived endoderm (Fig. 2b, S2c). Of note, in some of these cases, chromatin accessibility was noted in hESCs and pre-implantation embryo, but it significantly increases in a TE-subfamily and lineage-specific fashion in the corresponding differentiated derivative.
We then turned to later developmental stages, by comparing single-cell ATAC-seq data generated from 15 organs containing 54 different cell types derived from 12- to 17-week-old human fetuses29 with those obtained in pre-implantation embryo4 and in vitro-differentiated hESCs30. This led us to three observations. First, while ERVs contribute only about 8% of the human genome through some 600,000 integrants, they accounted for a quarter of the 1 million chromatin-accessible loci detected in fetal tissues (Fig. 2c). Second, the most significantly accessible TE subfamilies were largely primate-restricted (Fig. 2d). Third, profiles derived from single-cell chromatin accessibility of endodermal fetal organs revealed differential accessibility for distinct TE subfamilies that corresponded to their germ layer-restricted expression (Fig. 2e).
Together, these results suggest a model whereby chromatin at evolutionarily recent TE loci is opened in the human embryo, with lineage-specific patterns of accessibility and expression in the gastrula influencing the chromatin and transcriptional landscape of later developmental stages.
Tissue-specific transcription factors control lineage-restricted TE expression during human gastrulation
While the combined expression and accessibility of many TEs in pre-implantation embryo and hESCs reflects their recognition by pluripotency factors (Fig. S3a), the patterns observed at later stages for EGA-induced TE expression suggested regulation by cell type-specific TFs. To probe this hypothesis, we examined the transcriptional changes induced at TEs by individual overexpression of 328 TFs in epiblast-derived human embryonic stem cells (hESC), available through a recent publication31 (Fig. S3b, c). We found that, whereas more than 200,000 TE different loci were deregulated in the sum of all these experiments, each TF significantly induced only a restricted set of TE subfamilies (Fig. 3a, Fig. S3d, e). TEs previously noted to be transcribed during the minor and major waves of EGA, such as HERVL and HERVK respectively, were activated by their known cognate activators DUX4 and KLF4 (Fig. 3d, Fig. S3f), supporting the validity of our approach.
By matching the binding profiles of 268 TFs as defined in various cellular contexts32 with transcriptome studies performed in overexpressing hESCs31, we identified 156 factors that could bind to and induce the expression of 667 TE subfamilies (Supplementary Data 1). We then determined that 92 of these TF-TE pairs were expressed in gastrulating human embryos (Fig. 3b). Among them, overexpression in hESC of TFs considered as markers of particular germ layers, such as Brachyury for early mesoderm, GATA6 for meso-endoderm and SOX17 for endoderm and PGCs, induced the TE subfamilies expressed in the corresponding cells of the gastrulating embryo (Fig. 3b–d). Furthermore, these patterns correlated with their binding specificity, with the meso-endoderm-specific GATA6 recognizing and inducing both LTR5Hs-HERVK and LTR5B-HERVK integrants, but the endoderm/PGC-specific SOX17 doing so only on LTR5Hs-HERVK, as observed in gastrulating embryos (Fig. 3c, d, Fig. S3g).
Cell-type-specific TEeRS control gene expression during human gastrulation
Since chromatin accessibility is a known marker of cis-regulatory elements and reflects TF binding we asked whether the activation of TEeRS by cell-specific TFs controlled the expression of genes situated in their vicinity. To this end, we developed an algorithm aimed at predicting cis-regulatory activity33. In brief, we used a linear regression model to seek a correlation between the presence of specific TE subfamily members in the proximity of deregulated genes, which we expressed as an enhancer activity prediction score (Fig. S4a). To validate this approach, we inhibited simultaneously SVA- and LTR5Hs-embedded transcriptional units by dCAS9-KRAB (CRISPRi)-mediated repression in naïve hESC. We then calculated the cis-regulatory activity prediction scores of TE subfamilies, and confirmed that those most significantly affected in this setting corresponded to SVAs and LTR5Hs HERVK subfamilies targeted by CRISPRi (Fig. S4b). Conversely, KLF4 overexpression in primed hESC resulted in an increased cis-regulatory activity prediction score for LTR5Hs-derived HERVK (Fig. S4c), supporting our previous observation that this TF binds to these units and induces their transcription and acquisition of the H3K27ac active chromatin mark9,31.
We then applied our algorithm to the analysis of the 328 hESC-TF overexpression datasets. We proceeded to rank TE subfamilies according to their cis-regulatory activity prediction scores in each condition and found a strong correlation with both the percentage of up-regulated integrants and the overall level of induction of this TE subset for a given TF (Fig. 4a). Importantly, we also calculated the cis-regulatory activity prediction score of individual TE subfamilies in hESC-derived endodermal cells and found it to be significant for HERVK11, LTR5B- HERVK and HERVH (Fig. 4b), with our enhancer prediction scores correlating with increased H3K27ac loading, chromatin accessibility and expression of these TE integrants (Fig. 4c, Fig. S4d). To investigate experimentally the regulatory potential of a TEeRS located near a developmentally important gene, we targeted a putative enhancer harbored in an endodermal differentiation-specific TE (LTR6B) located upstream of the PRC2 subunit RBBP4 with CRISPRi in hESCs, and subjected these cells to an in vitro endodermal differentiation protocol (Fig. 4d, left panel). CRISPRi-induced repression of this LTR6B integrant resulted in RBBP4 downregulation (Fig. 4d, right panel). Of note, the RBBP4 gene is more highly expressed in human gastrula endoderm than in its murine counterpart, where this enhancer is absent because LTR6B is a primate-restricted ERV (Fig. S4e, ref. 34). To validate our observation functionally at the subfamily level, we also targeted the LTR5 consensus sequence with CRISPRi in hESC (Fig. S4f) and similarly proceeded to endodermal differentiation. This resulted in the downregulation of hundreds of genes located near the corresponding TE integrants (Fig. 4e). Furthermore, we applied our cis-regulatory prediction algorithm in this experimental setting and observed that the most significantly affected TE subfamily corresponded to CRISPRi-targeted LTR5B/Hs-derived HERVK (Fig. S4g). In addition, we were able to verify that the GATA6-binding sequence present in LTR5 conferred responsiveness to an enhancer-GFP reporter system in hESC-derived endoderm (Fig. 4f). Finally, by comparing gene expression in human and mouse endoderm we observed that, amongst TE subfamilies, LTR5Hs was one of the best predictor of human-specific cis-regulatory activity (Fig. S4h).
Together, these analyses and experimental data confirm that regulatory sequences hosted by TEs can act as species- and tissue-specific enhancers notably at play during early human development.
Primate-specific cis- and trans-regulators partner up to shape gene expression during human gastrulation
Of the hundred nearby genes downregulated upon LTR5 repression (Fig. S4i), 21 encode for KZFPs, a finding of interest since many members of this large family of DNA-binding proteins are responsible for silencing TEs through H3K9me3 deposition, histone deacetylation and DNA methylation35. Because of their expansion by gene and segment duplications, many KZFP genes are grouped in clusters, notably on human chromosome 19. We observed that KZFP genes located in the same genomic cluster are often of similar evolutionary age and are generally surrounded by insertions of contemporaneous TE subfamilies (Fig. 5a, Fig. S5a, b). Moreover, we noted that while KZFP gene expression globally decreases during differentiation, primate-restricted clusters display coordinated upregulation in specific cells of human gastrula (Fig. S5c, d).
Most KZFP genes (19 genes, 17 of them primate-restricted) repressed upon LTR5 CRISPRi-mediated silencing during endodermal differentiation reside in one such cluster, which we found to be enriched in LTR5B inserts (Fig. 5a). Eleven of these KZFP genes, which include ZNF611, ZNF600, ZNF28, ZNF468 and ZNF320, were more expressed in human gastrula endodermal cells and during in vitro endodermal differentiation of hESCs (Fig. 5ab). Correspondingly, we determined that GATA6 bound directly to numerous LTR5B integrants during endodermal differentiation and induced expression of LTR5B-HERVK and nearby KZFP genes when overexpressed in hESC (Fig. 5b). Additionally, CRISPRa-mediated activation of LTR5 in NCCIT teratocarcinoma cells led to the induction of KZFP genes flanked by integrants belonging to this TE subset (Fig. S5e, ref. 36).
Interestingly, we observed strong changes in the H3K9me3 landscape of TE loci between hESC and hESC-derived endodermal cells and noted a correlation with overlapping targets of LTR5-controlled KZFP genes (Fig. 5c). We notably observed LTR5-dependent increases in H3K9me3 enrichment over the transiently expressed HERVK11 subfamily in primitive-streak/nascent mesoderm during in vitro endodermal differentiation (Fig. 5d). Furthermore, applying our cis-regulatory activity prediction algorithm in the setting of LTR5-repressed endoderm-foregut differentiation yielded the highest score for MER11-HERVK11 integrants. Accordingly, upon CRISPRi-mediated targeting of LTR5 in hESC-derived foregut, we detected activation of several genes bearing MER11 inserts in their vicinity, including IQCG, DYSF and BAAT (Fig. S5f). These three genes were previously identified as co-expressed with MER11A in liver tissue37, and the liver-specific BAAT, mutations of which are associated with familial hypercholanemia38, uses a MER11A LTR as its primary promoter39. Most interestingly, we previously determined that the MER11A BAAT promoter is bound by the LTR5-stimulated endoderm-specific KZFPs ZNF468 and ZNF808 (Fig. 5f). This suggests a regulatory cascade where GATA6-mediated activation of LTR5 induces the expression of KZFPs repressing the transcription of MER11A-controlled genes in differentiating endoderm.
More generally, our results suggest a model whereby master TFs trigger a chain reaction during gastrulation by activating primate-restricted TEs controlling KZFPs of similar evolutionary age, which in turn repress these and other TE-based cis-acting regulatory elements, contributing to shape the chromatin and transcriptional landscape of the different germ layers. Therefore, transcriptional networks at play human development are controlled by a triangular relationship between canonical TFs, their primate-restricted TEeRS and evolutionarily related KZFPs countering their influences, the latter two endowing the regulome of human gastrulation and subsequent steps of fetal development with a high level of species-specificity.
Discussion
Together, these data demonstrate that transcriptional networks during human early development, while orchestrated by canonical TFs, are shaped by a partnership between primate-restricted TEeRS targeted by these activators and KZFP repressors countering their influences. As such, the regulome of human gastrulation displays a remarkable level of species-specificity reflecting the presence of both recently acquired TE integrants and KZFPs selected to tame their activity.
The broad expression of TEs such as HERVKs, HERVHs, SVAs, and young LINE-1s during EGA and in the PGC lineage3,40 is explained by their recognition by stem cell factors expressed during these periods, such as SOX2, OCT4, NANOG or KLF4/177,9,10,11,12,13. New TE integrants must seed the genome during the pre-implantation period or germline formation to become inherited, hence their expression at these timepoints. Interestingly, even though HERVH has been suggested to represent a human embryonic stem cell marker41, we observed that HERVH integrants displayed strong accessibility and expression in other cell types during development including PGC, axial mesoderm and definitive endoderm.
Our data indicate that TEeRS regulate subsequent steps of embryonic development in part through the recruitment of TFs active in germ layer determination, such as GATA6 and SOX17. More generally, it is well established that TEs can harbor binding sites for a wide array of TFs active in differentiated tissues, and the expression of some somatic genes, for instance in the immune system, is driven by TEeRS42,43,44,45. Additionally, primate-specific TEeRS are major contributors to cis-regulatory innovations in hESCs and adult liver46,47. The cis-regulatory influences of these recently emerged TEeRS on human fetal development suggest that, in spite of the evolutionary constraints proposed by the hourglasses developmental model48, all stages of this process are subject to regulatory innovation, and it is likely that gastrulation is influenced by lineage-restricted TE-hosted enhancers in other species as well, as already noted for placentation49. Supporting this hypothesis, tissue-specific TE subfamily expression was recently observed during mouse gastrulation50.
How the presence of binding sites for TFs typically active in differentiated tissues, which is predicted to promote neither the spread nor the inheritability of TEs, came to be selected through evolution is the object of much speculation51,52. However, we note here that primate-restricted ERVs are vastly overrepresented amongst TEs that harbor somatic TF binding sites, are expressed during gastrulation, and display an open chromatin state during fetal development. This is consistent with the observation that many act as enhancers or promoters in developing or differentiated organs53. As ERVs are derived from exogenous retroviruses that once replicated in somatic tissues and were largely endowed with oncogenic properties favoring their expansion and persistence, it maybe that the diversity of TF binding sites harbored by ERVs is just a consequence of their ancestry. But how was this feature maintained in evolution? Our finding that TEs activated during either EGA or gastrulation stimulate the transcription of KZFP genes, the products of which in turn repress these TEs and confer germ layer-specificity to their transcriptional influences, strongly suggests that KZFPs, rather than just the host side of an evolutionary arms race54, were instrumental in allowing for the preservation and exploitation of the broad regulatory potential of TEs in higher vertebrates.
Methods
hESC culture and differentiation
H9 and H1 human ESC line were maintained in mTSER plus on Matrigel and were passaged using TryplE in single cells. Endodermal differentiation was performed as in ref. 27. Briefly, hESC were passaged at 80 k cells/cm2 density in 12-well Matrigel-coated plate. When cells reached 80–90% confluence at 48–76 h post-splitting, endodermal differentiation was initiated with 100 ng/ml of Activin A for 3 days, 5 μM GSK-3 inhibitor (CHIR-99021) to activate the WNT pathway for the first day, and 0.5 μM for the second day. Pancreatic differentiation was performed accordingly to a Stem Cell TechnologyTM protocol (Catalog #05120) with harvest after 3 days of endodermal differentiation followed by 3 days of foregut differentiation. Gastruloid differentiation was performed as in ref. 28. Briefly, hESC were passaged at 40,000 cells/cm2 in mTSER replaced 48–76 h post-splitting by Nutristem media with 3 μM CHIR-99021. After 24 h cells were split in single-cell passaging with TryplE, embryoid bodies were formed with 800 cells per well of low adherence 96-well plate Cell Star in E6 media supplemented with 3 μM CHIR-99021 and 10 μM Rock inhibitor for 18 h, then replaced with E6 twice to be harvested at 72 h.
CRISPRi experiments
sgRNA design was performed by taking the Dfam consensus of LTR5B common sequence (TTGCAGTTGAGATAAGAGGAAGG). Furthermore, sgRNA design for LTR6B (GGCTTTGGGCGTTTATCAAT, TTGATAAACGCCCAAAGCCC, TATTACAAGGTGATAGATCC) perform to uniquely match chr1:33109510-33110065 (hg19). Specificity was predicted with the CRISPOR software v5.0155. hESCs in H9 media were transduced with dCAS9-KRAB lentiviral vector, selected, and maintained in puromycin (0.25 μg/mL) for 5 to 10 days before differentiation experiments.
ChIP-qPCR and RT-qPCR
ChIP were performed as in ref. 9 and primer use for HERVK11 were (Fw CCTTCCCATACTCGCAGTTC, Rv TGCATACAAGGACCAGCTCA) and for Neg (CCAATTTCGTGCCTCATTTT. TCAGCATGTCTCCTTTGCTG), RBBP4 (Fw ATGACCCATGCTCTGGAGTG, Rv GGACAAGTCGATGAATGCTGAAA) gene expression were normalized with ACTB (Fw CATGTACGTTGCTATCCAGGC, Rv CTCCTTAATGTCACGCACGAT). Reverse Transcriptions were performed using Thermo Scientific Maxima™ H Minus cDNA SynthesisMaster Mix ref #M1661.
ChIP-seq
Sequenced reads were aligned to the reference human genome hg19 with bowtie256. MACS 2.2.457 was used for peak calling. Peaks were merged using bedtools v2.27.158. FeatureCounts59 was used to count uniquely mapped reads (MAPQ > 10) on the peaks. Samtools tools v1.1 was used to convert in bam files. Library size correction was performed using the TMM method as implemented in the limma package of R, using the total number of aligned reads as size factor. All ChIP-seq binding locations from the literature were extracted from ChIP-Atlas database32 containing data for more than a thousand of chromatin associated proteins including more than 15'000 different datasets. Differential analysis on the uniquely mapped counts between conditions was performed with voom60. Heatmaps and profile averages were calculated using deeptools v3.5.161 over 5 kb windows around the peak/repeat center from bigwigs. Enrichment analysis over TE subfamilies was performed with HOMER software v4.10.462 and visualized in IGV v2.8.4 and ggplots v3.l.1 in R v4.l.2.
RNA-seq
Total RNA from cell lines was isolated with NucleoSpin™ RNA Plus kit (Machery-Nagel). cDNA was prepared with Maxima Reverse Transcriptase (Thermo Scientific). Sequencing libraries were performed with Illumina Truseq Stranded mRNA LT kit. Reads were mapped to the human (hg19) genome using Hisat2 v2.l.063. Counts on genes and TEs were generated using featureCounts v1.6.258 and only uniquely mapped reads with MAPQ > 10 were kept. To avoid read assignation ambiguity between genes and TEs, a gtf file containing both, genes and TEs was provided to featureCounts. For repetitive sequences, an in-house curated version of the Repbase database was used (fragmented LTR and internal segments belonging to a single integrant were merged). Only uniquely mapped reads were used for counting on genes and repetitive sequences integrants. TEs overlapping exons or that did not have at least one sample with 3 reads were discarded from the analysis. Normalization for sequencing depth was done for both genes and TEs using the TMM method as implemented in the limma package of Bioconductor64, with the counts on genes as library size. Finally, for each transgene, differential gene expression analysis was performed using Voom60 as it has been implemented in the limma package of Bioconductor v3.13 and assessing only genes (or TEs) that had 3 reads in at least one sample. A gene (or TE) was considered differentially expressed when the fold change between groups was bigger than 2 and the p-value was smaller than 0.05. A moderated t-test (as implemented in the limma package of R) was used to test significance. P-values were corrected for multiple testing using the Benjamini–Hochberg’s method. For counting on TE subfamilies, we added up reads on repetitive sequences without filtering out for multi-mapped reads and added them up per subfamily.
Cis-regulatory activity estimation
To identify TE subfamilies exerting putative cis-regulatory activities directly from RNA-seq data, we modeled treatment vs control deviations in gene expression of protein coding genes as a linear combination of occurrences of nearby (within 50 kb of the TSS of protein coding genes) TE subfamily integrants33. We excluded TEs overlapping exons and TE subfamilies that colocalized less than 150 times near the promoters of protein coding genes. The coefficients of this linear regression problem can be interpreted as the deviations of logged gene expression values explained by the presence of one TE for each TE subfamily. We define these coefficients as the cis-regulator activity of TE subfamilies. Similar models were proposed to infer the activity of DNA motifs from gene expression data65. To find TE subfamilies with significant cis-regulatory activities, we performed null significance hypothesis testing on the linear regression coefficients and accounted for multiple testing using the Benjamini–Hochberg procedure.
Enhancer reporter system
We used a lentiviral vector containing a minimal promoter followed of GFP cDNA (FpG5, Addgene #69443) containing a full LTR from LTR5 subfamily amplified from a LTR5B (chr19:53226814-53227799, hg19). Then a single mutation was generated using Agilent Technologies QuikChange II XL (Cat#200522-5). H9 hESC were transduced by either of these enhancer-containing vectors followed by 3 days of endodermal differentiation and then analyze by FACS (FlowJo LCC v8.8.7).
ATAC-seq studies
Reads were aligned with bowtie2. Mitochondrial reads were removed before peak calling. Peak calling was done with MACS2 with q < 10e-5, and using the --bampe option when PE reads.
Single-cell multi-omics
Cellranger-arc66 was used to obtain counts on genes and peaks using default parameters. The hg38 reference genome provided by cellranger-arc was used. We identified five main clusters in this experimental system: TBXT-expressing axial mesoderm, SOX2-expressing neuro-mesenchymal progenitors (NMP), and three different stages of paraxial mesoderm differentiation preferentially expressing TBX6 (somitic), or PAX3/TWIST1/SIX1 (early paraxial and pre-somitic) with a different degree of somitic HOX gene markers (Fig. 2c, Fig. S2b–e). Cellular clustering matched increased chromatin accessibility with the corresponding cell-type-specific TF binding sites, such as illustrated for TBXT (Fig. S2f).
Single-cell RNA-seq analyses
For the human embryo dataset, counts were obtained using cellranger67 using a GTF of hg19 that contained both, genes and TEs. Only uniquely mapped reads on genes that were expressed in at least 1% of the samples and in a minimum 3 cells for TEs were kept. Then, for TEs not overlapping exons, counts were added up at subfamily level. Cells with less than 200 features and more than 25% of mitochondrial reads were removed. Seurat’s SCTransform68 was used to normalize the data and correct for mitochondrial percentage and total number of reads biases. For embryoid-body time course differentiation, same method was apply except that only cells with more than 20% of mitochondrial reads were removed. UMAP were computed with Seurat’s R package v4.1.0 with default parameters using the first 30 principal components as input. Of note, our and Tyler et al.’s UMAPs only present minimal differences, yet axial mesoderm and endoderm appear slightly closer when depicted with our analytical pipeline.
Single-cell ATAC-seq analyses
Single-cell ATAC-seq peaks data were downloaded from the Atlas Of Chromatin Accessibility During Development (https://atlas.brotmanbaty.org/bbi/human-chromatin-during-development/)29. Significance for TE family chromatin accessibility enrichment was assessed by random permutations: First, for each TE subfamily, the total number of detected peaks for a given cell type on the selected TE subfamily was computed using R GenomicRanges library v1.48.0. Then, TE subfamilies were randomly shuffled 10 times using bedtools with options –chrom and –noOverlapping and the total number of peaks for each permutation was computed. The fold enrichment of the significant subfamilies was then plotted on a heatmap using R heatmap2 function for each cell type.
TE density profiling
TE bigwig densities were computed using python. First, TEs, were extracted from the TE database depending on their subfamily evolutionary ages in bed format and converted to bedgraph using the genomecov command of BedTools v2.27.1. Then, bedgraph signals were smoothed using a rectangular window of 10 kb and written in bigwig format using the pyBigWig python library v0.3.18.
Statistics & reproducibility
No statistical method was used to predetermine sample size. No data were excluded from the analyses. The experiments were not randomized The Investigators were partly blinded to allocation during experiments and outcome assessment. All experiments contain at least 2 biologically independent replicates (for RNA-seq) and more than 3 for ChIP/RT-qPCR and FACS analysis. Figures 1d, S1d, 2a: p-value using non-parametric Wilcoxon rank sum test with Seurat algorithm. Figure 2a, c, d, S2c, S3a, S5b, Supp Data 1: p-value using Homer algorithm (annotatePeaks.pl). Figures S2c, 4a, 5a, Supplementary Data 1: p-value using a two-sided t test. Fig. 3a, b, S3d–f, 4a, S5f, Fig. 4b, S4f, g: p-value using two-sided t test with correction for multiple testing using the Benjamini–Hochberg’s method.
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
Data availability
The Single-cell multi-omics of gastruloid, RNA-seq of endodermal differentiated hESC with or without LTR5-targeting sgRNA generated have been deposited in the deposited in the Gene Expression Omnibus (GEO) database under accession number GSE181120. without restricted access.
All other genomic data of this study were extracted from the GEO database: GSE140021 for the 10X single-cell RNA-seq of hESC-derived embryoid body time course; GSE120648 for ATAC-seq of purified PGC during hESC-derived embryoid body differentiation; GSE117136 and GSE52657 for ChIP-seq and ATAC-seq from endodermal differentiation; GSE130418 for ATAC-seq of naïve and primed hESCs; Single-cell ATAC-seq from fetal organ: https://descartes.brotmanbaty.org/. E-MTAB-9388 for the SMART-seq single-cell RNA-seq of human gastrula from EBI database. DRA006296 for the overexpression dataset of TF in hESC from DDBJ database. hg19 reference genome wer used from UCSC. No restriction for dataset availability. Source data are provided as a Source Data file. Source data are provided with this paper.
Code availability
All code used will be provided upon request and is available on Github [https://github.com/julienpontis/TE-Gastrulation].
References
Sundaram, V. & Wysocka, J. Transposable elements as a potent source of diverse cis-regulatory sequences in mammalian genomes. Philos. Trans. R. Soc. Lond. B Biol. Sci. 375, 20190347 (2020).
Chuong, E. B., Elde, N. C. & Feschotte, C. Regulatory activities of transposable elements: from conflicts to benefits. Nat. Rev. Genet. 18, 71–86 (2017).
Göke, J. et al. Dynamic transcription of distinct classes of endogenous retroviral elements marks specific populations of early human embryonic cells. Cell Stem Cell 16, 135–141 (2015).
Gao, L. et al. Chromatin accessibility landscape in human early embryos and its association with evolution. Cell 173, 248–259.e15 (2018).
Liu, L. et al. An integrated chromatin accessibility and transcriptome landscape of human pre-implantation embryos. Nat. Commun. 10, 364–11 (2019).
Wu, J. et al. Chromatin analysis in human early development reveals epigenetic transition during ZGA. Nat. Publ. Group 557, 256–260 (2018).
Kunarso, G. et al. Transposable elements have rewired the core regulatory network of human embryonic stem cells. Nat. Genet. 42, 631–634 (2010).
Fort, A. et al. Deep transcriptome profiling of mammalian stem cells supports a regulatory role for retrotransposons in pluripotency maintenance. Nat. Genet. 46, 558–566 (2014).
Pontis, J. et al. Hominoid-specific transposable elements and KZFPs facilitate human embryonic genome activation and control transcription in naive human ESCs. Cell Stem Cell 24, 724–735.e5 (2019).
Wang, J. et al. Primate-specific endogenous retrovirus-driven transcription defines naive-like stem cells. Nat. Publ. Group 516, 405–409 (2014).
Ohnuki, M. et al. Dynamic regulation of human endogenous retroviruses mediates factor-induced reprogramming and differentiation potential. Proc. Natl Acad. Sci. USA 111, 12426–12431 (2014).
Grow, E. J. et al. Intrinsic retroviral reactivation in human preimplantation embryos and pluripotent cells. Nature 522, 221–225 (2015).
Barakat, T. S. et al. Functional dissection of the enhancer repertoire in human embryonic stem cells. Stem Cell 23, 276–288.e8 (2018).
Haring, N. L. et al. ZNF91 deletion in human embryonic stem cells leads to ectopic activation of SVA retrotransposons and up-regulation of KRAB zinc finger gene clusters. Genome Res. 31, 551–563 (2021).
Greenberg, M. V. C. & Bourc’his, D. The diverse roles of DNA methylation in mammalian development and disease. Nat. Rev. Mol. Cell Biol. 20, 590–607 (2019).
Friedli, M. & Trono, D. The developmental control of transposable elements and the evolution of higher species. Annu. Rev. Cell Dev. Biol. 31, 429–451 (2015).
Guo, H. et al. The DNA methylation landscape of human early embryos. Nat. Publ. Group 511, 606–610 (2014).
Smith, Z. D. et al. DNA methylation dynamics of the human preimplantation embryo. Nat. Publ. Group 511, 611–615 (2014).
Fueyo, R., Judd, J., Feschotte, C. & Wysocka, J. Roles of transposable elements in the regulation of mammalian transcription. Nat. Rev. Mol. Cell Biol. https://doi.org/10.1038/s41580-022-00457-y (2022).
Yang, P., Wang, Y. & Macfarlan, T. S. The role of KRAB-ZFPs in transposable element repression and mammalian evolution. Trends Genet. 1–11 https://doi.org/10.1016/j.tig.2017.08.006 (2017).
Turelli, P. et al. Primate-restricted KRAB zinc finger proteins and target retrotransposons control gene expression in human neurons. Sci. Adv. 6, eaba3200 (2020).
Ecco, G. et al. Transposable elements and their KRAB-ZFP controllers regulate gene expression in adult tissues. Dev. Cell 36, 611–623 (2016).
Playfoot, C. J. et al. Transposable elements and their KZFP controllers are drivers of transcriptional innovation in the developing human brain. Genome Res. 31, 1531–1545 (2021).
Wolf, G. et al. The KRAB zinc finger protein ZFP809 is required to initiate epigenetic silencing of endogenous retroviruses. Genes Dev. 29, 538–554 (2015).
Tyser, R. C. V. et al. Single-cell transcriptomic characterization of a gastrulating human embryo. Nat. Publ. Group 600, 285–289 (2021).
Chen, D. et al. Human Primordial Germ Cells Are Specified from Lineage-Primed Progenitors. Cell Rep. 29, 4568–4582.e5 (2019).
Lee, K. et al. FOXA2 is required for enhancer priming during pancreatic differentiation. Cell Rep. 28, 382–393.e7 (2019).
Moris, N. et al. An in vitro model of early anteroposterior organization during human development. Nat. Publ. Group 582, 410–415 (2020).
Domcke, S. et al. A human cell atlas of fetal chromatin accessibility. Science 370, eaba7612 (2020).
Pastor, W. A. et al. TFAP2C regulates transcription in human naive pluripotency by opening enhancers. Nat. Cell Biol. 20, 553–564 (2018).
Nakatake, Y. et al. Generation and profiling of 2135 human ESC lines for the systematic analyses of cell states perturbed by inducing single transcription factors. Cell Rep. 31, 107655 (2020).
Oki, S. et al. ChIP-Atlas: a data-mining suite powered by full integration of public ChIP-seq data. EMBO Rep. 19, e46255 (2018).
Pulver, C. et al. Statistical learning quantifies transposable element-mediated cis-regulation. bioRxiv https://doi.org/10.1101/2022.09.23.509180 (2022).
Pijuan-Sala, B. et al. A single-cell molecular map of mouse gastrulation and early organogenesis. Nat. Publ. Group 566, 490–495 (2019).
Ecco, G., Imbeault, M. & Trono, D. KRAB zinc finger proteins. Development 144, 2719–2729 (2017).
Fuentes, D. R., Swigut, T. & Wysocka, J. Systematic perturbation of retroviral LTRs reveals widespread long-range effects on human gene regulation. Elife 7, e35989 (2018).
Pavlicev, M., Hiratsuka, K., Swaggart, K. A., Dunn, C. & Muglia, L. Detecting endogenous retrovirus-driven tissue-specific gene transcription. Genome Biol. Evol. 7, 1082–1097 (2015).
Carlton, V. E. H. et al. Complex inheritance of familial hypercholanemia with associated mutations in TJP2 and BAAT. Nat. Genet. 34, 91–96 (2003).
Cohen, C. J., Lock, W. M. & Mager, D. L. Endogenous retroviral LTRs as promoters for human genes: a critical assessment. Gene 448, 105–114 (2009).
Tang, W. W. C. et al. A unique gene regulatory network resets the human germline epigenome for development. Cell 161, 1453–1467 (2015).
Santoni, F. A., Guerra, J. & Luban, J. HERV-H RNA is abundant in human embryonic stem cells and a precise marker for pluripotency. Retrovirology 9, 111–115 (2012).
Bourque, G. et al. Evolution of the mammalian transcription factor binding repertoire via transposable elements. Genome Res. 18, 1752–1762 (2008).
Sundaram, V. et al. Widespread contribution of transposable elements to the innovation of gene regulatory networks. Genome Res. 24, 1963–1976 (2014).
Ito, J. et al. Systematic identification and characterization of regulatory elements derived from human endogenous retroviruses. PLoS Genet. 13, e1006883 (2017).
Chuong, E. B., Elde, N. C. & Feschotte, C. Regulatory evolution of innate immunity through co-option of endogenous retroviruses. Science 351, 1083–1087 (2016).
Trizzino, M. et al. Transposable elements are the primary source of novelty in primate gene regulation. Genome Res. 27, 1623–1633 (2017).
Jacques, P.-É., Jeyakani, J. & Bourque, G. The majority of primate-specific regulatory sequences are derived from transposable elements. PLoS Genet. 9, e1003504 (2013).
Development, D. D. Temporal colinearity and the phylotypic progression: a basis for the stability of a vertebrate Bauplan and the evolution of morphologies through heterochrony. journals.biologists.com (1994).
Sun, M.-A. et al. Endogenous retroviruses drive lineage-specific regulatory evolution across primate and rodent placentae. Mol. Biol. Evolution 38, 4992–5004 (2021).
He, J. et al. Identifying transposable element expression dynamics and heterogeneity during development at the single-cell level with a processing pipeline scTE. Nat. Commun. 12, 1456 (2021).
Sundaram, V. & Wang, T. Transposable element mediated innovation in gene regulatory landscapes of cells: re-visiting the ‘Gene-Battery’ model. BioEssays 40, (2018).
Britten, R. J. & Davidson, E. H. Repetitive and non-repetitive DNA sequences and a speculation on the origins of evolutionary novelty. Q Rev. Biol. 46, 111–138 (1971).
Pehrsson, E. C., Choudhary, M. N. K., Sundaram, V. & Wang, T. The epigenomic landscape of transposable elements across normal human development and anatomy. Nat. Commun. 10, 5640 (2019).
Jacobs, F. M. J. et al. An evolutionary arms race between KRAB zinc-finger genes ZNF91/93 and SVA/L1 retrotransposons. Nature 516, 242–245 (2014).
Haeussler, M. et al. Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR. Genome Biol. 17, 148 (2016).
Langmead, B. & Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 9, 357–359 (2012).
Zhang, Y. et al. Model-based analysis of ChIP-Seq (MACS). Genome Biol. 9, R137 (2008).
Quinlan, A. R. & Hall, I. M. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841–842 (2010).
Liao, Y., Smyth, G. K. & Shi, W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30, 923–930 (2014).
Law, C. W., Chen, Y., Shi, W. & Smyth, G. K. voom: Precision weights unlock linear model analysis tools for RNA-seq read counts. Genome Biol. 15, R29 (2014).
Ramírez, F., Dündar, F., Diehl, S., Grüning, B. A. & Manke, T. deepTools: a flexible platform for exploring deep-sequencing data. Nucleic Acids Res. 42, W187–W191 (2014).
Heinz, S. et al. Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. Mol. Cell 38, 576–589 (2010).
Kim, D., Langmead, B. & Salzberg, S. L. HISAT: a fast spliced aligner with low memory requirements. Nat. Methods 12, 357–360 (2015).
Gentleman, R. C. et al. Bioconductor: open software development for computational biology and bioinformatics. Genome Biol. 5, R80 (2004).
Balwierz, P. J. et al. ISMARA: automated modeling of genomic signals as a democracy of regulatory motifs. Genome Res. 24, 869–884 (2014).
Satpathy, A. T. et al. Massively parallel single-cell chromatin landscapes of human immune cell development and intratumoral T cell exhaustion. Nat. Biotechnol. 37, 925–936 (2019).
Molè, M. A. et al. A single cell characterisation of human embryogenesis identifies pluripotency transitions and putative anterior hypoblast centre. Nat. Commun. 12, 3679 (2021).
Stuart, T. et al. Comprehensive integration of single-cell data. Cell 177, 1888–1902.e21 (2019).
Tyser, R. C. V. et al. A spatially resolved single cell atlas of human gastrulation. bioRxiv 2020.07.21.213512 https://doi.org/10.1101/2020.07.21.213512 (2020).
Jostes, S. V. et al. Unique and redundant roles of SOX2 and SOX17 in regulating the germ cell tumor fate. Int. J. Cancer 146, 1592–1605 (2020).
Loh, K. M. et al. Efficient endoderm induction from human pluripotent stem cells by logically directing signals controlling lineage bifurcations. Cell Stem Cell 14, 237–252 (2014).
Imbeault, M., Helleboid, P.-Y. & Trono, D. KRAB zinc-finger proteins contribute to the evolution of gene regulatory networks. Nat. Publ. Group 543, 550–554 (2017).
Acknowledgements
We thank Shankar Srinivas, Antonio Scialdone and Elmir Mahammadov for providing single-cell expression raw data of the human gastrula and pseudotime data, the EPFL Genomics and the University of Lausanne Genomic Technologies facilities for help with sequencing, Alfonso Martinez Arias and Naomi Moris for discussing results obtained from their gastruloid protocol, and Alexandre Mayran for critical reading of the manuscript. We thank Thomas Pontis for drawing the featured image. This study was supported by grants from the Swiss National Science Foundation and the European Research Council (KRABnKAP, no. 268721; Transpos-X, no. 694658) to D.T.; by fellowships from the EPFL/Marie Skłodowska-Curie Fund, the Association pour la Recherche sur le Cancer (ARC), and the Fondation Bettencourt to J.P.
Author information
Authors and Affiliations
Contributions
J.P. and D.T. conceived the study. J.P., D.T., and C.Pu. wrote the manuscript; J.P. designed and performed all experiments with the technical help of S.O. and C.Pl; C.Pu. developed and applied the cis-regulatory activity algorithm; J.P., C.Pu, E.P., D.G., and J.D. performed the bioinformatics analyses; A.M. and M.L. provided valuable advice for gastruloid experiments.
Corresponding authors
Ethics declarations
Competing interests
The authors declare no competing interests.
Ethics approval
The commonly used H1 and H9 human embryonic stem cell lines were originally derived from embryos produced using in vitro fertilization for reproduction and no longer needed for this purpose, and donated through voluntary written consent for use in research. The import and use of these cells was authorized by Swiss Federal Office of Public Health after approval by the Canton of Vaud Ethics Committee (Authorization Number R-FP-S-2-0009-0000). All experiments reported in this manuscript were performed under Authorization Number R-FP-S-2-0014-0000.
Peer review
Peer review information
Nature Communications thanks the anonymous reviewers for their contribution to the peer review of this work.
Additional information
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Source data
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Pontis, J., Pulver, C., Playfoot, C.J. et al. Primate-specific transposable elements shape transcriptional networks during human development. Nat Commun 13, 7178 (2022). https://doi.org/10.1038/s41467-022-34800-w
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41467-022-34800-w
- Springer Nature Limited
This article is cited by
-
Gapped-kmer sequence modeling robustly identifies regulatory vocabularies and distal enhancers conserved between evolutionarily distant mammals
Nature Communications (2024)
-
Jump-starting life: balancing transposable element co-option and genome integrity in the developing mammalian embryo
EMBO Reports (2024)
-
Transposable elements contribute to tissue-specific gene regulation in humans
Genes & Genomics (2024)
-
Identification of constrained sequence elements across 239 primate genomes
Nature (2024)
-
Statistical learning quantifies transposable element-mediated cis-regulation
Genome Biology (2023)