Abstract
The genus Flavivirus contains more than 70 single-stranded, positive-sense arthropod-borne RNA viruses. Some flaviviruses are particularly medically important to humans and other vertebrates including dengue virus (DENV), West Nile virus, and yellow fever virus. These viruses are transmitted to vertebrates by mosquitoes and other arthropod species. Mosquitoes are also infected by insect-specific flaviviruses (ISFs) that do not appear to be infective to vertebrates. Cell fusing agent virus (CFAV) was the first described ISF, which was discovered in an Aedes aegypti cell culture. We found that while CFAV infection could be significantly reduced by application of RNAi against the NS5 gene, removal of the treatment led to quick restoration of CFAV replication. Interestingly, we found that CFAV infection significantly enhanced replication of DENV, and vice versa, DENV infection significantly enhanced replication of CFAV in mosquito cells. We have shown that CFAV infection leads to increase in the expression of ribonuclease kappa (RNASEK), which is known to promote infection of viruses that rely on endocytosis and pH-dependent entry. Knockdown of RNASEK by dsRNA resulted in reduced DENV replication. Thus, increased expression of RNASEK induced by CFAV is likely to contribute to enhanced DENV replication in CFAV-infected cells.
Similar content being viewed by others
Introduction
Flaviviruses have single-stranded positive sense RNA genomes and are transmitted to vertebrate species mostly by mosquitoes and other arthropods1. A number of these viruses cause serious diseases leading to considerable morbidity and mortality around the world. Among mosquito-borne flaviviruses are dengue virus (DENV), West Nile virus, Japanese encephalitis virus and yellow fever virus. Because of poor vector control and lack of effective vaccines or drugs, the resurgence and expansion of mosquito-borne diseases has been an important global health concern in recent decades; for example dengue and Zika, which are most commonly transmitted by the mosquito Aedes aegypti 2.
Mosquitoes can also become infected by insect-specific flaviviruses (ISFs) that do not infect vertebrates. Cell fusing agent virus (CFAV) was the first described ISF discovered from an Ae. aegypti cell line3. It was later reported from Ae. aegypti mosquitoes in Puerto Rico4. It is believed that this virus is transmitted vertically4 and therefore the embryos used to initiate the original cell line must have been infected. CFAV has similar genome size, structure and gene order to other flaviviruses. For example, there is over 40% identity of the amino acid sequence of the NS5 protein between CFAV and other flaviviruses5. It has been reported that segments of the CFAV genome have integrated into Ae. aegypti and Ae. albopictus genomes6, which suggests that CFAV has been persistently infecting the mosquitoes for a long time. However, it is unclear what functional role the CFAV plays in mosquitoes.
While coinfections or superinfections (sequential infections) of a variety of homologous or heterologous arboviruses has been tested in different insect cell lines (mostly in C6/36 cells) and mosquitoes (reviewed in refs 7 and 8), none of these studies included CFAV. In these studies, the outcomes of coinfections or superinfections were either negative or no interference. In this study, we investigated infection of Ae. aegypti cell lines, Aag2 and Aa20, with CFAV and explored the interaction of CFAV with DENV.
Materials and Methods
Insect cell lines
Ae. aegypti Aag2 cells were maintained in a medium with a 1:1 mixture of Mitsuhashi-Maramorosch and Schneider’s insect media (Invitrogen) supplemented with 10% FBS and in the presence of penicillin (100 U ml−1) and streptomycin (100 μg ml−1). Aa20 cells established from Ae. aegypti larvae were kindly provided by the late Prof Richard Elliott. The cells were maintained in Leibovitz’s L15 medium supplemented with 10% FBS and 10% Tryptose phosphate broth9. To infect Aa20 cells with CFAV, Aag2 culture medium containing the virus (Fig. 1) was collected, centrifuged at 2150× g for 5 min to remove cells and debris, and used as a CFAV inoculation source. The titre of CFAV was determined using tissue culture infectious dose50 (TCID50) endpoint fixed cell-enzyme-linked immunosorbent assay method as previously described10.
RNA extraction, cDNA synthesis and polymerase chain reaction (PCR)
Total RNA from mosquito cells was isolated using Tri-Reagent (Ambion Inc., USA) after removal of medium and washing cells three times with PBS. RNA was incubated with DNase I at 37 °C for 10 min and then inactivated at 75 °C for 10 min. The first strand cDNA was synthesized by reverse transcription (RT) with CFAV-specific or poly(dT) primers (for ribosomal protein S17, RPS17, housekeeping gene detection as control). In each RT reaction, approximately 2 µg of total RNA was used as template in a volume of 20 μl. Following cDNA synthesis, 2 μl of RT products was used for each PCR in a total reaction volume of 25 μl with CFAV NS5 gene-specific primers (Forward: 5′-GCCCACATCTGGGCRTRNGCCTTNGC-3′; Reverse: 5′-GGGCAAGTARBMACTTATGCVTTGAACAC-3′). These are referred to as CFAV-specific detection primers. Amplification was performed at 95 °C for 1 min, followed by 35 cycles of 95 °C for 30 sec, 56 °C for 30 sec, 68 °C for 1 min, and a final extension at 68 °C for 5 min. PCR products were run on agarose gels, stained by ethidium bromide, and bands were visualized in a gel documentation system (Red, Proteinsimple) using UV light. Images were recorded and shown in negative.
RT-qPCR
Total RNA was extracted from mosquito cells and treated with DNase I. The synthesis of first strand cDNA was carried out using a specific reverse primer to DENV or CFAV (CFAV-qR 5′-CACAACGGTAGCGAGAGACA-3′). Following the RT, qPCRs with DENV (forward: 5′-GTGGTGGTGACTGAGGACTG-3′; reverse: 5′-CCATCCCGTACCAGCATCCG-3′) and CFAV specific primers (CFAV-qF 5′-CTGATGTGCGTGCAGTTCTT-3′ and CFAV-qR) were carried out to determine the DENV and CFAV genomic RNA levels in cells. Platinum SYBR Green Mix (Invitrogen) was used for qPCR with 1 μl of RT products in a Rotor-Gene thermal cycler (QIAGEN) as described above. The RPS17 gene was used for normalizing data as described previously11. Each reaction was run with 3 biological replicates, each with 3 technical replicates. The relative abundance of viral RNA to the host reference gene was determined by qGENE software and analyzed using GraphPad Prism.
RNAi-mediated silencing
For RNAi-based experiments, dsRNAs were synthesized in vitro using the T7 MEGAscript transcription kit according to the manufacturer’s instruction (Ambion Inc., USA). T7 promoter sequences (TAATACGACTCACTATAGGG) were incorporated in both forward and reverse primers designed to amplify an around 500 bp fragment of the CFAV NS5 (forward: 5′-GAGGAGGATCTGGAGGATGA-3′; reverse: 5′-CCCTCGCCACCTGTACCTTA-3′). These are referred to as CFAV RNAi primers, which were different to the CFAV-specific detection primers. For dsRNA synthesis, 200–500 ng of PCR product were used for each reaction. Reaction was incubated at 37 °C overnight, DNase-treated and precipitated by the lithium chloride method following the manufacturer’s instruction. A total of 4 μg of dsRNA was used to transfect Aag2 cells with 5 μl of Cellfectin transfection reagent (Invitrogen). The cells were transfected again with the same reagent at 48 h intervals after the first transfection. Cells were collected for RNA extraction as required for further analysis at 24 h after the second transfection. Gene silencing was confirmed by RT-PCR using CFAV-specific detection primers.
RNASEK (accession no. XM_001663743.1) was silenced as described above using forward (5′-CTATATCCATAGTGTGGCGC-3′) and reverse (5′-AGCAACAGTTGTGCGACTGT-3′) primers with T7 promoter sequences incorporated in them. Silencing of the gene was confirmed by qPCR forward (5′-CCGATCTGTGGACCCAAACT-3′) and reverse (5′-GAAGACACCCATCAGGAGCA-3′) primers, outside the dsRNA region.
In-cell Western plaque assay
Vero cells (an African green monkey cell line) were seeded into a 96-well plate and incubated at 37 °C overnight until 90–100% confluent. Medium from DENV-infected cells was diluted into four dilutions: 100, 10−1, 10−2, 10−3. Fifty µl of virus solution was added into each well and incubated at room temperature for 1 h, then incubated at 37 °C for an additional hour. The inoculum was removed, and cells were overlaid with 47.5% medium and 47.5% of carboxymethyl cellulose gel supplemented with 4% FBS. After 72 h incubation at 37 °C, gels were discarded and cells were fixed with ice cold 80% acetone in PBS at −20 °C for 20 min. Plate was dried fully. Fifty µl 5% skin milk in PBST as blocking solution was added to each well and incubated at 37 °C for 0.5 h. Fifty µl of first antibody (anti-DENV2-Envelope protein antibody 1:1000 dilution in PBST) was added into each well and incubated at 4 °C for 2 h. Then, cells were washed three times with PBS containing 0.05% Tween 20. Secondary IR dye conjugated antibody (Sigma) was added (1:2500 dilution), and incubated at 37 °C for 1.0 h. Cells were washed three times with PBS containing 0.05% Tween 20. Plate was scanned using LI-COR Biosciences Odyssey Infrared Imaging System and plaques were counted.
Statistical analysis
Unpaired t-test was used to compare differences between two individual groups, while one-way ANOVA with Tukey’s post-hoc test was carried out to compare differences between more than two groups. Data that did not pass the normality test were re-analysed by the non-parametric Wilcoxon test indicated in their relevant figure legends.
Results
CFAV was found in Ae. aegypti Aag2 cells, but not in Aa20 cells
Cell fusing agent virus (CFAV), from the genus Flavivirus, was originally isolated from an Ae. aegypti cell line (Peleg) in laboratory3. In contrast to the majority of known flaviviruses, CFAV is an ISF and does not have a vertebrate host3. Firstly, we investigated the presence of CFAV in Ae. aegypti cell lines available to us by RT-PCR with CFAV-specific detection primers. Results showed that CFAV RNA was present in Aag2 cells as previously reported12, but not in Aa20 cells (Fig. 1). Consistently, CFAV was only detected in the medium from Aag2 cells and not in that of Aa20 cells (Fig. 1). Because Aag2 is one of the most commonly used mosquito cell lines and that existing CFAV infection might affect the physiology and transcriptional profiling of the cells, we attempted to remove CFAV from Aag2 cells by transfecting them with dsRNA to CFAV NS5. After using NS5 dsRNA for five passages in Aag2 cells, RT-PCR results showed that CFAV RNA was hardly detectable (Fig. 2A). However, when the NS5 dsRNA transfection was stopped, CFAV RNA could be detected again already in the first passage, and its levels recovered as quickly as by passage 3 to the level observed in the original Aag2 cells (Fig. 2B).
CFAV promotes dengue virus infection in mosquito cells
To determine whether prior infection of mosquito cells with CFAV may affect subsequent infection by DENV, Aa20 CFAV-free cells were infected with CFAV, collected from supernatant of cultured Aag2 cells persistently infected with CFAV. We confirmed infection of Aa20 cells with CFAV (Aa20 + CFAV cells) seven days after the inoculation using CFAV-specific detection primers (Fig. 3A). The result also confirmed that Aag2 cells produce infectious CFAV particles and that detection of CFAV RNA in the cells correlates with virus production (also see Fig. 4E which shows active replication of CFAV in Aa20 cells). Subsequently, Aa20 and Aa20 + CFAV cells were infected with MOI 1 of DENV-2 and total RNA was extracted at 72 h after infection and analysed by RT-qPCR with gene-specific primers to DENV-2. RT-qPCR results revealed that the relative abundance of DENV RNA was significantly higher in Aa20 + CFAV cells as compared with Aa20 cells (Fig. 3B). In addition, we carried out a plaque assay using the medium collected from the infected cells at 72 h post infection, which showed significantly higher DENV-2 titers in Aa20 + CFAV cells as compared with Aa20 cells (Fig. 3C and D).
DENV enhances replication of CFAV in mosquito cells
The above results showed that CFAV promoted the replication of DENV in cells. To investigate whether DENV reversely influences the replication of CFAV, Aag2 cells and Aa20 + CFAV cells were inoculated with DENV. Total RNA at 72 hpi was extracted and analysed by RT-PCR with CFAV-specific detection primers. RT-PCR results showed that the CFAV RNA levels were higher in Aag2 cells infected with DENV as compared with mock-infected Aag2 cells (Fig. 4A). Similarly, in Aa20 + CFAV cells that were used at 7 days after CFAV infection, the CFAV RNA levels were found to be higher at 3 days following DENV infection as compared with DENV non-infected Aa20 + CFAV cells (Fig. 4B). The results suggest that DENV mutually enhances replication of CFAV.
We also examined the dynamics of the effect of DENV infection on CFAV and vice versa. For this, Aag2 cells that are already infected with CFAV were infected with MOI 0.1 of DENV. RNA was extracted from cells at 1, 3 and 5 dpi of DENV and analysed by RT-qPCR using specific primers to CFAV. While in mock-infected Aag2 cells CFAV levels remained constant, in those infected with DENV, there was an increase in CFAV levels, although this was only statistically significant at 3 dpi (Fig. 4C), consistent with Fig. 4A. To examine the effect of CFAV on DENV infection, Aa20 cells were infected either with DENV alone or DENV together with CFAV (both at 0.1 MOI). RT-qPCR results showed significant but modest increase in the levels of DENV RNA in Aa20 cells when co-infected with CFAV at 1 and 3 dpi, while it decreased at 5 days post-infection (Fig. 4D). It appears that when Aa20 cells were already infected with CFAV prior to DENV infection, the effect on DENV was more prominent (Fig. 3) as compared to when they were co-infected with both viruses at the same time. Similarly, co-infection of Aa20 cells with CFAV and DENV enhanced CFAV replication as compared to CFAV infection alone (Fig. 4E). In an independent experiment, in which Aa20 cells were infected either with DENV alone or co-infected with CFAV, more DENV virions were found in the media collected from cells with CFAV-DENV co-infection at 4 dpi (Fig. 5).
Increase in RNASEK by CFAV and its effect on DENV
In testing a number of genes (five genes cecropin, defensin, attacin, domeless and RNASEK) reported in the literature to be involved in insect virus-host interactions and immunity13,14,15,16,17,18, we noticed a significant increase in the transcript levels of RNASEK in Aa20 + CFAV cells as compared to Aa20 cells (Fig. 6A). The genes were assessed based on their transcriptional changes in response to DENV infection analysed by RT-qPCR. RNASEK was also highly expressed in Aag2 cells as compared to Aa20 cells that are devoid of CFAV (Fig. 6B). Ribonuclease kappa (RNASEK) was shown to promote infection of a range of viruses that rely on endocytosis and pH-dependent entry, including DENV16. The role of RNASEK in replication of these viruses was examined in Drosophila S2 cells and human osteosarcoma cells (U2OS) but not in mosquito cells. To confirm that RNASEK promotes DENV replication in mosquito cells, we silenced RNASEK in Aa20 cells by transfection of dsRNASEK into the cells (Fig. 7A) followed by their infection with 1 MOI of DENV-2. After 72 h, RT-qPCR analysis revealed significantly less DENV gRNA present in dsRNASEK-transfected cells as compared with mock or dsGFP transfected cells (Fig. 7B). This result was further confirmed by plaque assay using media collected from cells in the silencing experiment, which clearly showed substantially less infectious DENV in the media from cells transfected with dsRNASEK as compared with the controls (Fig. 7C and D). The data show that RNASEK knockdown results in reduction of DENV RNA in infected cells and of infectious virus in the culture fluid.
Discussion
With the utilization of advanced next generation sequencing approaches for viral detection/discovery, there has been a significant increase in the isolation and characterization of ISFs recently19,20,21,22,23,24,25,26,27. The existence of ISFs in mosquitoes may affect their vector competence in transmission of pathogenic arboviruses to vertebrate hosts. For instance, in Culex pipiens, Culex flavivirus (CxFV) suppressed dissemination of West Nile virus (WNV) at early stages of infection (7 days), which may consequently affect the severity of enzootic transmission of WNV by the mosquito28, 29. In addition, it was reported that CxFV from Guatemala could significantly enhance the transmission rate of WNV in Culex quinquefasciatus from Honduras30. Similarly, another ISF, Palm Creek virus, repressed replication of WNV and Murray Valley encephalitis virus in mosquito cells, but did not repress replication of the alphavirus Ross River virus27. Further, Eilat virus, reduced replication of several mosquito-borne viruses such as Sindbis virus, eastern, western, and Venezuelan equine encephalitis viruses, and Chikungunya virus26. While the majority of examples indicate that ISFs may have a negative effect on the replication of pathogenic flaviviruses, we found rather positive interaction of CFAV and DENV; although as mentioned above in the case of CxFV and WNV in Cx. quinquefasciatus, our observation is not the first instance of a positive interaction between an ISF and a pathogenic flavivirus.
Cell fusing agent virus (CFAV) was the first described ISF, which was discovered in an Ae. aegypti cell culture named Peleg3. Different strains of the virus have also been detected from field-collected Ae. aegypti and other mosquito species4, 21, 31, 32 CFAV has similar genome size, structure and gene order to other flaviviruses33. In the present study, CFAV was detected in Ae. aegypti Aag2 cell line, but not in another Ae. aegypti cell line, Aa20. Because Aag2 cells are one of the commonly used mosquito cells, and a persistent infection with CFAV could affect the cells’ biology and response to other infections, we attempted to remove it from Aag2 cells by RNAi using CFAV NS5-specific dsRNA. After continuous transfection of dsRNA into the cells for five passages, CFAV RNA was hardly detectable in the treated cells. Unfortunately, once the dsRNA application was stopped, CFAV came back as soon as one passage and was completely restored to its original levels in three passages. We also found that CFAV significantly promoted the replication of DENV in mosquito cells, particularly if cells were already infected with CFAV prior to DENV infection. Conversely, DENV was also found to moderately enhance the replication of CFAV in Ae. aegypti cells.
RNASEK is a protein with two putative transmembrane regions that is highly conserved across vertebrates and invertebrates but its function is largely unknown34, 35. A recent study demonstrated that RNASEK promotes the uptake of viruses that enter host cell via clathrin-mediated endocytic route (e.g. flaviviruses, alphaviruses, bunyaviruses, and orthomyxoviruses) but not those that fuse at the cell membrane (e.g. picornavirus and paramyxovirus)16. Furthermore, RNASEK was shown to be associated with vATPase and required for the function of vATPase throughout the cells17, and depletion of either of the genes led to increase in the pH of endosomes. We also found that silencing RNASEK resulted in reduction in DENV replication in mosquito cells, which corroborates with previous studies with other viruses. Interestingly, our results showed that RNASEK expression was significantly increased in CFAV-infected mosquito cells, which may explain the enhancement of DENV infection in these cells.
With more deep sequencing data becoming available from insects and cell lines showing the presence of a variety of undetected viruses that have established persistent infections, it might be rare that we find a cell line or an insect lab colony that is completely free of any virus. While these cell lines and insect colonies continue to be useful as tools in laboratories, depending on the experimental design and aims of the study, caution should perhaps be undertaken in interpretation of data.
References
Roby, J., Hall, R. A. & Khromykh, A. A. In Molecular virology and control of flaviviruses (ed. P-Y. Shi) 21–50 (Caister Academic Press, 2012).
Halstead, S. B. Dengue virus-mosquito interactions. Annu Rev Entomol 53, 273–291 (2008).
Stollar, V. & Thomas, V. L. An agent in the Aedes aegypti cell line (Peleg) which causes fusion of Aedes albopictus cells. Virology 64, 367–377 (1975).
Cook, S. et al. Isolation of a new strain of the flavivirus cell fusing agent virus in a natural mosquito population from Puerto Rico. J Gen Virol 87, 735–748 (2006).
Yamanaka, A., Thongrungkiat, S., Ramasoota, P. & Konishi, E. Genetic and evolutionary analysis of cell-fusing agent virus based on Thai strains isolated in 2008 and 2012. Infect Genet Evol 19, 188–194 (2013).
Crochu, S. et al. Sequences of flavivirus-related RNA viruses persist in DNA form integrated in the genome of Aedes spp. mosquitoes. J Gen Virol 85, 1971–1980 (2004).
Salas-Benito, J. & De Nova-Ocampo, M. Viral interference and persistence in mosquito-borne flaviviruses. J Immunol Res 2015, 873404 (2015).
Kean, J. et al. Fighting arbovirus transmission: Natural and engineered control of vector competence in Aedes mosquitoes. Insects 6, 236–278 (2015).
Pudney, M., Varma, M. & Leake, C. Establishment of cell lines from larvae of culicine (Aedes species) and anopheline mosquitoes. TCA Mannual 5, 997–1002 (1979).
O’Brien, C. A. et al. Viral RNA intermediates as targets for detection and discovery of novel and emerging mosquito-borne viruses. PLoS Negl Trop Dis 9, e0003629 (2015).
Hussain, M., Frentiu, F. D., Moreira, L. A., O’Neill, S. L. & Asgari, S. Wolbachia utilizes host microRNAs to manipulate host gene expression and facilitate colonization of the dengue vector Aedes aegypti. Proc Natl Acad Sci USA 108, 9250–9255 (2011).
Scott, J. C. et al. Comparison of Dengue virus type 2-specific small RNAs from RNA interference-competent and –incompetent mosquito cells. PLoS Negl Trop Dis 4, e848 (2010).
Souza-Neto, J. A., Sim, S. & Dimopoulos, G. An evolutionary conserved function of the JAK-STAT pathway in anti-dengue defense. Proc Natl Acad Sci USA 106, 17841–17846 (2009).
Pan, X. et al. Wolbachia induces reactive oxygen species (ROS)-dependent activation of the Toll pathway to control dengue virus in the mosquito Aedes aegypti. Proc Natl Acad Sci USA 109, E23–31 (2012).
Luplertlop, N. et al. Induction of a peptide with activity against a broad spectrum of pathogens in the Aedes aegypti salivary gland, following infection with dengue virus. PLoS Pathog 7, e1001252 (2012).
Hackett, B. A. et al. RNASEK is required for internalization of diverse acid-dependent viruses. Proc Natl Acad Sci USA 112, 7797–7802 (2015).
Perreira, J. M. et al. RNASEK is a V-ATPase-associated factor required for endocytosis and the replication of rhinovirus, influenza A Virus, and dengue virus. Cell Rep 12, 850–863 (2015).
Xi, Z., Ramirez, J. L. & Dimopoulos, G. The Aedes aegypti Toll pathway controls dengue virus infection. PLoS Pathog 4, e1000098 (2008).
Crabtree, M. B., Sang, R. C., Stollar, V., Dunster, L. M. & Miller, B. R. Genetic and phenotypic characterization of the newly described insect flavivirus, Kamiti River virus. Arch Virol 148, 1095–1118 (2003).
Crabtree, M. B., Nga, P. T. & Miller, B. R. Isolation and characterization of a new mosquito flavivirus, Quang Binh virus, from Vietnam. Arch Virol 154, 857–860 (2009).
Hoshino, K. et al. Genetic characterization of a new insect flavivirus isolated from Culex pipiens mosquito in Japan. Virology 359, 405–414 (2007).
Cook, S. et al. Isolation of a novel species of flavivirus and a new strain of Culex flavivirus (Flaviviridae) from a natural mosquito population in Uganda. J Gen Virol 90, 2669–2678 (2009).
Junglen, S. et al. A new favivirus and a new vector: characterization of a novel flavivirus isolated from Uranotaenia mosquitoes from a tropical rain forest. J Virol 83, 4462–4468 (2009).
Bolling, B. G., Eisen, L., Moore, C. G. & Blair, C. D. Insect-specific flaviviruses from Culex mosquitoes in Colorado, with evidence of vertical transmission. Am J Trop Med Hyg 85, 169–177 (2011).
Calzolari, M. et al. Detection of mosquito-only flaviviruses in Europe. J Gen Virol 93, 1215–1225 (2012).
Nasar, F., Erasmus, J. H., Haddow, A. D., Tesh, R. B. & Weaver, S. C. Eilat virus induces both homologous and heterologous interference. Virology 484, 51–58 (2015).
Hobson-Peters, J. et al. A new insect-specific flavivirus from northern Australia suppresses replication of West Nile virus and Murray Valley encephalitis virus in co-infected mosquito cells. PLoS ONE 8, e56534 (2013).
Bolling, B. G., Olea-Popelka, F. J., Eisen, L., Moore, C. G. & Blair, C. D. Transmission dynamics of an insect-specific flavivirus in a naturally infected Culex pipiens laboratory colony and effects of co-infection on vector competence for West Nile virus. Virology 427, 90–97 (2012).
Bolling, B. G., Weaver, S. C., Tesh, R. B. & Vasilakis, N. Insect-specific virus discovery: significance for the arbovirus community. Viruses 7, 4911–4928 (2015).
Kent, R. J., Crabtree, M. B. & Miller, B. R. Transmission of West Nile virus by Culex quinquefasciatus Say infected with Culex flavivirus Izabal. PLoS Neglect Trop Dis 4, e671 (2010).
Espinoza-Gómez, F. et al. Detection of sequences from a potentially novel strain of cell fusing agent virus in Mexican Stegomyia (Aedes) aegypti mosquitoes. Arch Virol 156, 1263–1267 (2011).
Kihara, Y. et al. Rapid determination of viral RNA sequences in mosquitoes collected in the field. J Virol Methods 146, 372–374 (2007).
Cammisa-Parks, H., Cisar, L., Kane, A. & Stollar, V. The complete nucleotide sequence of cell fusing agent (CFA): homology between the nonstructural proteins encoded by CFA and the nonstructural proteins encoded by arthropod-borne flaviviruses. Virology 189, 511–524 (1992).
Economopoulou, M. A., Fragoulis, E. G. & Sideris, D. C. Molecular cloning and characterization of the human RNase kappa, an ortholog of Cc RNase. Nucleic Acids Res 35, 6389–6398 (2007).
Kiritsi, M. N., Fragoulis, E. G. & Sideris, D. C. Essential cysteine residues for human RNase k catalytic activity. FEBS J 279, 1318–1326 (2012).
Acknowledgements
The authors would like to thank Prof Paul Young and Dr Daniel Watterson from UQ for anti-DENV2-Envelope protein antibody, and Roy Hall and Jody Peters from UQ for providing the antibody for CFAV titration. This project was funded by the Australian Research Council grant (DP150101782) to SA, National Health and Medical Research Council (NHMRC, APP1062983) to SA and AAK, and the NHMRC Research Fellowship to AAK (AAP1059794).
Author information
Authors and Affiliations
Contributions
G.Z. designed experiments, carried out experiments, analysed data and drafted the manuscript. SAsa carried out the plaque assays for CFAV and DENV time trials. A.A.K. designed experiments and edited the manuscript. SAsg conceived the study, designed experiments and edited the manuscript. All authors read and approved the final manuscript.
Corresponding author
Ethics declarations
Competing Interests
The authors declare that they have no competing interests.
Additional information
Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Electronic supplementary material
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Zhang, G., Asad, S., Khromykh, A.A. et al. Cell fusing agent virus and dengue virus mutually interact in Aedes aegypti cell lines. Sci Rep 7, 6935 (2017). https://doi.org/10.1038/s41598-017-07279-5
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41598-017-07279-5
- Springer Nature Limited
This article is cited by
-
Cell fusing agent virus rarely transmits vertically in artificially infected laboratory-colonized Aedes aegypti mosquitoes
Parasites & Vectors (2024)
-
Cell fusing agent virus isolated from Aag2 cells does not vertically transmit in Aedes aegypti via artificial infection
Parasites & Vectors (2023)
-
Mosquito vector competence for dengue is modulated by insect-specific viruses
Nature Microbiology (2023)
-
Aedes aegypti and Ae. albopictus microbiome/virome: new strategies for controlling arboviral transmission?
Parasites & Vectors (2022)
-
N6-methyladenosine modification of the Aedes aegypti transcriptome and its alteration upon dengue virus infection in Aag2 cell line
Communications Biology (2022)