Abstract
Finding a novel drug delivery system (DDS) represents one of the most challenging endeavors in cancer therapy. Hence, in this study, we developed a new biocompatible and biodegradable zinc-based nanoscale metal–organic framework (Zn-NMOF) coated with folic acid (FA) functionalized chitosan (CS) to facilitate targeted delivery of doxorubicin (D), a standard chemotherapeutic agent, into breast cancer cells. The synthesis of the NMOF-CS-FA-D nanocomposite preceded its comprehensive characterization via FT-IR, DLS, XRD, SEM, and TEM analyses. Subsequent in vitro studies were conducted on MCF-7 breast cancer cells and HFF-1 normal cells, encompassing assessments of cell viability, expression levels of apoptotic and autophagy genes, cell cycle arrest, and apoptotic analyses. The size of the NMOF-CS-FA-D particles was determined to be less than 80 nm, with a drug loading efficiency of 72 ± 5%. The release kinetics of DOX from the nanocomposite were investigated, revealing controlled release behavior at pH 7.4 and accelerated release at pH 5.0, which is conducive to drug delivery into cancer cells. In vitro results indicated a 17.39% ± 6.34 cell viability after 24 h of treatment with a 40 nM concentration of the NMOF-CS-FA-D nanocomposite. Furthermore, the expression levels of Caspase-9 and BAX, key apoptotic genes, along with BECLIN1, an autophagy gene, were found to increase by two-fold, four-fold, and two-fold, respectively, following 5 h of treatment with the nanocomposite. Additionally, analysis of cell cycle distribution revealed 15.4 ± 2% of cells in the sub-G1 phase, indicative of apoptotic cells, and 31.9% of cells undergoing early and late apoptosis in MCF-7 cells. Collectively, these findings underscore the potential of the NMOF-CS-FA-D nanocomposite in inhibiting cancer cell proliferation with low side effects.
Similar content being viewed by others
Introduction
Cancer and its therapy represent pivotal topics in human health. Among various cancers, breast cancer stands out as the most frequently diagnosed carcinoma in women worldwide, posing a significant threat to their lives and contributing to high mortality rates annually1,2. Breast cancer has now become the second leading cause of mortality among females3. Conventional therapeutic approaches for breast cancer include surgery, radiotherapy, hormone therapy, and chemotherapy4. However, these methods are fraught with challenges such as nonspecificity, adverse effects on healthy tissues, low treatment stability, and high drug dosage requirements, among others, limiting their efficacy in cancer prognosis, diagnosis, and therapy5,6,7. Hence, there is a pressing need for multifunctional strategies to enhance drug delivery efficiency and inhibit cancer progression.
Nanoparticles have emerged as a promising class of drug delivery systems (DDSs) aimed at overcoming the limitations of conventional methods in cancer therapy, improving drug delivery efficacy, and reducing side effects8. Various biocompatible and biodegradable organic and inorganic-based nanocarriers, including solid lipid nanocomposites, inorganic materials, hydrogels, and polymeric nanoparticles, have been developed as efficient DDSs.
Among these DDSs, nanoscale metal − organic frameworks (NMOFs) have garnered significant attention due to their exceptional properties, including large surface area, functional ability, suitable pore size, biocompatibility, and other practical aspects9,10. NMOFs, composed of self-assembled metal ions/clusters and organic linkers, offer a versatile platform for various biomedical applications, particularly in DDSs. The construction of NMOFs relies on weaker intermolecular interactions and strong intramolecular metal–ligand π–π interactions, resulting in a stable structure11,12. Additionally, NMOFs exhibit structural stability at physiological pH levels while disintegrating at lower pH levels facilitates the controlled release of therapeutic agents at target sites13,14. Polymeric nanoparticles such as chitosan (CS) have been shown to enhance therapeutic agent half-life, surface modification efficiency, and protection from enzymatic degradation, thereby improving DDS efficacy15. CS nanoparticles possess numerous advantages, including biodegradability, serum stability, water solubility, non-cytotoxicity, favorable pharmacokinetic and pharmacodynamic profiles, non-immunogenicity, ease of modification, wide distribution, and cost-effectiveness, making them promising candidates for efficient DDSs with applications in wound dressing, tissue engineering, among others16,17. The surface modification of CS nanoparticles with ligands such as folic acid (FA) further enhances their efficacy as DDSs18. FA, a highly potent targeting ligand for cancer cells, exploits the overexpression of FA receptors on the surface of various cancers to facilitate receptor-mediated internalization of FA-decorated nano-complexes into cancer cells8,19. Since the FA receptor, a glycosylphosphatidylinositol-anchored membrane glycoprotein has been considerably overexpressing on the surface of various cancers such as colon, breast, ovary, lung, kidney, etc., it can covalently bind to its receptor with high affinity and consequently, induces the transportation of FA-decorated nano-complex to cancer cells vis receptor-mediated internalization20,21. It has been reported that the FA receptor overexpresses 10 times more in cancer cells than in normal cells19. Therefore, using FA-functionalized nanocomposites could be considered an efficient DDS for the delivery of therapeutic agents such as doxorubicin (DOX) to cancer cell growth inhibition22,23. DOX, as an anthracycline drug, is commonly applied for the treatment of different cancers such as breast, stomach, ovarian, acute lymphoblastic leukemia, brain, lung, etc.24. The use of FA-functionalized nanocomposites as DDSs holds promise for delivering therapeutic agents such as doxorubicin (DOX) for cancer cell growth inhibition25. The DOX has an inhibitory effect on the proliferation of cancer cells and induces cell apoptosis by targeting different members of the phosphoinositide 3-kinase (PI3K)/protein kinase B (AKT)/mTOR signaling pathway, insulin receptor substrate 1, and IGF-I receptor-mediated pathway in cancer cells which, in turn, leads to activation of Caspse9, BAX, ATG5, and BECLIN1 mediators (as apoptosis and autophagy elements)26,27. Apoptosis and programmed necrosis contribute to cell death and autophagy plays a prominent role in the pro-survival or pro-death fate of cells. Hence, the promotion of autophagy can potentially induce cell death, omit cancer cells, and subsequently reduce tumor size.
In the present study, FA functionalized CS nanoparticle was developed and followed by coating on novel synthesized Zn-NMOF nanocomposite. Then, DOX as a standard chemotherapeutic agent was loaded into the mentioned nanocomposite, and drug loading efficiency was measured. The syntheses were characterized by analytical devices, including UV–Vis, FT-IR, DLS, XRD, SEM, and TEM. The drug release manner of nanocomposite was also evaluated. Afterward, the sort of biomedical tests such as cell viability assay, apoptosis and autophagy genes expression, apoptosis phase, and cell cycle arrest were implemented on MCF-7 human breast cancer and HFF1 human foreskin fibroblast cell lines to investigate the cancer cell growth inhibition potency of the synthesized nanocomposite.
Materials and methods
Materials and apparatus
Zinc acetate dihydrate (Zn(OAc)2.2H2O), CS (low molecular weight: 50,000–190,000 Da; Viscosity: 20–300 cp), NH4OH, zinc nitrate dihydrate (Zn(NO3)2.2H2O, 99%), FA, N, N′-dimethylacetamide, and absolute ethanol were bought from Sigma Aldrich. Additionally, polyvinyl pyrrolidone (PVP), N, N dimethylformamide (DMF), terephthalic acid (TPA), 1,4 diazabicyclo[2.2.2]octane (DABCO), 1-(3-dimethylaminoproply)-3-ethylcarbodiimide hydrochloride (EDC), absolute isopropanol, monochloroacetic acid, and sodium dodecyl sulfate (SDS) were purchased from Sigma Aldrich. The fetal bovine serum (FBS) and MTT (3-(4, 5-Dimethyl thiazol-2-yl)-2,5-diphenyl tetrazolium bromide) were also prepared from Sigma Aldrich. The human breast cancer MCF-7 and normal human foreskin fibroblast HFF1 cell lines were bought from the Institute of Pasteur, Iran.
The analytical assessment of samples was implemented using a Fourier transform infrared (FT-IR: Perkin-Elmer 843), X-ray diffraction (XRD), and NanoDrop 2000c UV–Vis (Thermo scientific) spectrometers. Also, dynamic light scattering (DLS) investigation of syntheses was determined by NanoBrook 90 Plus (Brookhaven, USA). Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) images were taken applying Philips EM 208S (Netherlands).
Synthesis of NMOF nanocomposite
NMOF nanocomposite was synthesized by the following procedure. Under strong sonication, 132 mg of zinc acetate dihydrate was dissolved in 14 mL of DMF and sonicated for 15 min. In the following, 100 mg of TPA and 350 mg of DABCO were separately dissolved in 6.5 mL of DMF and stirred at 50 rpm for 10 min at room temperature. At that point, the arranged blend was included in zinc acetic acid derivation dried out drop by drop, and subjected to ultrasound for 15 min. The resulting solution was centrifuged at 8000 rpm for 30 min, the supernatant was thrown away, and the precipitant was washed with DMF for accurate purification. In what follows, NMOF was prepared for the next phase of synthesis as the following. Practically, 220 mg of sodium dodecyl sulfate, 15 mL of absolute ethanol, and 250 µL of acetic acid were added to the above-mentioned mixture and followed by sonication for 2 h at room temperature. Ultimately, the synthesized nanocomposite was saved at 4 °C for analytical evaluation via FT-IR and XRD devices18.
Synthesis of NMOF-CS
In this phase, a CS-coated NMOF nanocomposite was developed according to the reported approach28. Firstly, 50 mg of NMOF dissolved in 10 mL absolute ethanol under stirring at 50 rpm. Secondly, 82 mg of CS was dissolved in 10 mL of 1% acetic acid (v/v) and stirred for 24 h at 50 rpm to attain a homogenous solution. Then, the prepared CS and NMOF solutions were mixed and stirred at 50 rpm for 48 h. Afterward, the synthesized chitosan-coated NMOF was collected by centrifuging at 8000 rpm for 30 min and washed with 10 mL of absolute ethanol three times18.
Synthesis of FA functionalized CS (NMOF-CS-FA)
Conjugation of FA to CS was performed according to the following procedure19. Practically, 280 mg of FA and 100 mg of EDC were suspended in 12 mL of anhydrous DMSO under strong stirring for 2 h at room temperature and dark conditions to obtain an even solution. Afterward, 50 mg of CS was dissolved in 10 mL of 1% acetic acid (v/v) followed by 2 h of stirring at room temperature. Then, the CS solution was slowly added to the prepared FA mixture and stirred for 16 h at room temperature. In the following, the pH of the solution was adjusted to 7 by 1 mL of NaOH 1 M solution. Subsequently, the FA-CS was gathered by centrifuging at 8000 rpm for 30 min and freeze-dried to keep at 4 °C.
Preparation of NMOF-CS-FA and DOX-loaded NMOF-CS-FA (NMOF-CS-FA-D)
To achieve NMOF-CS-FA, 41 mg of CS was dissolved in 1% acetic acid (v/v) followed by adding 41 mg of CS-FA to that solution. The mixture was stirred for 24 h at 50 rpm and room temperature to attain a homogenous solution. In what follows, the prepared solution was suspended in previously synthesized NMOF and stirred at 50 rpm and room temperature for 48 h. Then, the prepared NMOF-CS-FA was collected by centrifuging at 8000 rpm for 30 min and washed with 10 mL of absolute ethanol three times. In the second phase, DOX as a chemotherapeutic agent was loaded into NMOF-CS-FA nanocomposite by the following approach. Firstly, a certain value of DOX salt was dissolved in DMSO as an appropriate solvent. Then, 0.4 µM of DOX-containing solution was poured into 50 µM of NMOF-CS-FA nanocomposite and stirred at 50 rpm and room temperature for 48 h for efficient drug loading. This experiment was performed under dark conditions. Thereafter, the DOX-loaded nanocomposite was washed with distilled water.
Characterization of nanocomposites
The analytical devices, including FT-IR and XRD spectroscopies, were implemented to investigate the quality of synthesized nanocomposites. Moreover, the TEM and SEM microscopic assays were performed to determine the size, structure, and surface morphology of the prepared samples. Additionally, the hydrodynamic size of fabricated specimens was evaluated via DLS.
Drug loading efficiency and release study
To measure the drug loading capacity (DLC) and drug loading efficiency (DLE) of the drug-loaded nanocomposite, the NMOF-CS-FA-D solution was centrifuged at 13,000 rpm for 30 min to separate the supernatant from the carrier. Then, the DOX concentration of the supernatant was calculated by measuring its absorbance in a Nano-drop UV–visible spectrophotometer at 480 nm. Eventually, the DLC and DLE were calculated according to the following equations:
In the second phase, the DOX release behavior from synthesized nanocomposite was investigated by incubating in PBS at 37 °C, under 100 rpm shaking, and pH 5.0 (as acidic environment) and 7.4 (as physiologic environment). A 12,000 Da cut-off of the dialysis membrane tubing was prepared and submerged in water at 25 °C for 10 h before use. Thereafter, the NMOF-CS-FA-D was dispersed in 3 mL of PBS and transferred into a dialysis tube. Then, the dialysis tube was entered into a beaker containing 150 mL of the PBS as a release medium (37 °C, pH 5.0 and 7.4) and placed on a shaker. In what follows, 10 µL of release medium was pitted out at different intervals of time (1, 2, 3, 4, 5, 24, 48, 72 h) for Nano-drop UV–Vis absorbance measurement of released DOX at 480 nm and followed by replacing 10 µL of fresh PBS in the beaker.
Cell culture
The human breast cancer (MCF-7) cell line and human foreskin fibroblast cells (HFF1) as a normal cell line were purchased from the Pasture Institute of Iran. The MCF-7 and HFF1 cells were separately cultured in the RPMI medium (Gibco, UK) supplemented with 10% FBS, 2 mM glutamine, 100 μg/mL streptomycins, and 100 IU/mL penicillin.
MTT assay
In this experiment, the growth inhibitory effects of the synthesized nanocomposites, including the NMOF-CS, NMOF-CS-D, NMOF-CS-FA, and NMOF-CS-FA-D were scrutinized on MCF-7 and HFF1 cell lines, and mitochondrial dehydrogenase activity was ascertained22. Firstly, 5, 10, 20, and 40 nM concentrations of the synthesized nanocomposites were prepared in a serum-supplemented tissue culture medium which was sterilized by 0.2 mm filtration at pH 7.4. Then, the cytotoxic potency of nanocomposites was investigated on the MCF-7 and HFF1 cell lines. In the cell culture phase, the 5000 cells/100 μL of the MCF-7 and HFF1 cells were seeded in each well of 96-well microtiter plates. After being cultivated overnight at 37 °C under 5% CO2, the culture medium of the microtiter plates was replaced by 150 μL serial dilutions of the specimens, and the cells were incubated for 24, 48, and 72 h in an incubator at 37 °C and 5% CO2. Thereafter, the prepared specimens of nanocomposites were replaced by 200 μL of RPMI without serum. Subsequently, 0.5 mg MTT/mL was prepared in PBS at pH 7.4, added to each well, and incubated for 4 h. Then, the suspension liquid was removed and the cells were re-suspended in 200 mL DMSO and the optical density (OD) of the converted dye was read at 570 nm.
Gene expression assay
In this experiment, the quantitative Real-Time PCR (qRT-PCR) was applied to scrutinize the relative expression level of apoptotic and autophagy genes, including Caspase-9, BAX, BECLIN1, and ATG5 after 5 h of treatment with 40 nM of NMOF-CS-FA-D nanocomposite in MCF-7 cell line by Q Rotor-Gene (Qiagen, Iran). For potential optic evaluation of cancer cell inhibition performance of nanocomposite, the incubation time should be performed under 8 h; therefore, the incubation time of 5 h was considered for this test. As in the experimental section, total RNA was first isolated via the following procedure. The MCF-7 cells were mixed with RNX-PLUS solution followed by merging in 200 µL chloroform. Then, the solution was centrifuged at 13,000 rpm for 4 min under 4 °C. In what follows, the supernatant was gathered and isopropanol was added to the supernatant which was followed by centrifuging at 13,000 rpm for 15 min under 4 °C. Afterward, the supernatant was thrown away and precipitation was merged in 1 mL of ethanol 75%. In the next phase, 1000 ng of total RNA was utilized for the reverse transcription process to synthesize cDNA by the following. Practically, 10 µL of Master mix real-time, 3 µL (10 ng) RNA and 7 µL double distilled water were spilled in microtubes, and synthesizing cDNA was performed. Thereafter, the qRT-PCR approach was implemented with a 14 µL reaction mixture containing 1 µL of cDNA, 7 µL of low rox Master mix real-time, and 0.5 µL of forward primer (Caspase-9: 5ʹTGGCTCCTGGTACGTTGA3ʹ; BAX: 5ʹTTTCTGACGGCAACTTCAACTG3ʹ; BECLIN1: 5ʹGATGATGTCCACAGAAAGTGC3ʹ; ATG5: 5ʹCATTCAGAAGCTGTTTCGTCCT3ʹ; GAPDH: 5ʹGTGGTCTCCTCTGACTTCAAC3ʹ) and 0.5 µL of reverse primer (Caspase-9: 5ʹGAAACAGCATTAGCGACCCT3ʹ; BAX: 5ʹTCCAATGTCCAGCCCATGA3ʹ; BECLIN1: 5ʹ AGTGACCTTCAGTCTTCGG3ʹ; ATG5: 5ʹCTCAGATGTTCACTCAGCCAC3ʹ; GAPDH: 5ʹGGAAATGAGGCTTGACAAAGTGG3ʹ). In the following, PCR temperature was set using an RT-qPCR device as the following: heating at 95 °C for 10 min, 45 cycles at 95 °C for 15 s, annealing at 59 °C for 25 s, and elongation at 72 °C for 30 s. Ultimately, relative gene expression values (n = 5 per group and time point) were normalized to glyceraldehyde-3-phosphate-dehydrogenase (GAPDH), and results were calculated as fold change relative to the control.
Cell cycle analysis
The cycle arrest analysis was performed to investigate the MCF-7 breast cancer cells’ destiny after treatment with 40 nM of synthesized NMOF-CS-FA-D and NMOF-CS-FA nanocomposite as the following method. Firstly, MCF-7 cancer cells were seeded in a 6-well plate (2 × 105 cells/well) and incubated for 5 h; for potential optic assessment of cancer cell cycle inhibition potency of the nanocomposite, the incubation time was selected under 8 h; therefore, the incubation time of 5 h was considered for this test. In the following, the culture medium of each well was replaced with the fresh medium-prepared nanoparticle samples and allowed for 5 h of incubation. After washing cells with PBS three times, MCF-7 cells were trypsinized and continued by washing with PBS three times. Eventually, MCF-7 cells were collected in a falcon tube by centrifuging at 1000 rpm for 4 min which was followed by staining with PI at 4 °C for 40 min under light-protected conditions and subjected to flow cytometry for ascertaining the cell cycle arrest values.
Cell apoptosis analysis
To evaluate the apoptotic values of the MCF-7 cancer cell line after treatment with NMOF-CS-FA-D and NMOF-CS-FA nanocomposites the annexin V-FITC/propidium iodide (PI) approach was carried out22. Firstly, 2 × 105 cells/1 mL of MCF-7 cells were put in each well of a six-well plate and incubated under 37 °C and 5% CO2 at 24 h for growing up. Then, the MCF-7 cells were treated with 40 nM of the synthesized nanocomposites for 5 h under 37 °C and 5% CO2. Thereafter, the MCF-7 breast cancer cell-containing wells were exposed to PBS (three times) for washing and continued by trypsinizing and centrifuging at 1000 rpm for 4 min to collect the detached cells. Subsequently, the Annexin V-FITC and propidium iodide dye treatment was performed on MCF-7 cells and the cells were incubated for 15 min under dark conditions. Eventually, the cells were subjected to a flow cytometer for determining cell apoptosis.
Statistical analysis
The experiments were repeated at least three times and outputs were reported as mean ± standard error of the mean. A comparison of each group was assessed by one-way analysis of variance (ANOVA) and T-test. The differences were considered significant for *p < 0.05.
Results and discussion
Characterization of synthesized nanocomposites
FT-IR analysis
The FT-IR spectroscopy was carried out to evaluate the quality of synthesis of nanocomposites (NMOF, NMOF-CS, NMOF-CS-FA, and NMOF-CS-FA-D) by forming and deforming the chemical and physical interactions and presence of ligand’s functional groups (Fig. 1). According to these spectra, NMOF showed an absorption peak at around 3436/cm which related to O–H stretching vibration in adsorbed H2O molecules in the NMOF structure. Also, the characteristic bonds at 3717/cm (aromatic C–H), 1384/cm (aromatic C=O and symmetric stretching of the O–C=O bonded to Zn), and 1504/cm (aromatic C=C) are assigned to NMOF nanocomposite30,31. For CS-coated NMOF nanocomposite, the peaks at 2921/cm and 1648/cm correspond to C–H stretching vibration and C=O stretching of the amide group attributed to CS, respectively. Moreover, the characteristic peaks that appeared at around 1430/cm, 1163/cm, and 680/cm are related to the absorbance of glucoside bond, –C–O–C–, and CH bending vibrations, respectively. Additionally, the absorption peaks for –OH groups were obtained at around 3434/cm, and 1151/cm (asymmetric stretching of –C–O–C– bridge) while a peak at 1034/cm is attributed to the C–N bond of CS15. The characteristic peaks revealed at around 1639/cm, 1541/cm, 1388/cm, and 1068/cm are assigned to C=O, N–H bending, C–N stretching, and C–O stretching vibrations at CS, respectively. For FA functionalized CS-coated nanocomposite the absorption peaks were revealed at around 3545/cm and 3415/cm (N–H stretch of primary amine and amide), 1695/cm (aromatic C=C bending and stretching), and 3328/cm (alkyl C–H and C=C stretch). Besides, the peak at around 1492/cm (CH–NH–C=O amides bending) is attributed to FA and amide bond formation15,18. On the other hand, the broad peak at around 3318/cm in DOX-loaded nanocomposite is indicative of doxorubicin OH. Furthermore, the peak at around 1085/cm corresponds to the C–O stretching band, and aromatic peaks at around 1564/cm and 1641/cm approve the presence of DOX in NMOF-CS-FA-D. Also, the characteristic peaks of DOX at around 3416/cm and 1665/cm confirm the hydrogen-bonded OH stretching and C=O stretching in the structure of nanocomposite, respectively28,29.
The FT-IR spectra of NMOF, NMOF-CS, NMOF-CS-FA, and NMOF-CS-FA-D nanocomposites. Absorption peaks are demonstrating the quality of NMOF synthesis and effective CS-FA coating and DOX loading in the nanocomposite.
XRD analysis
The XRD approach is one of the strongest techniques for surveying the structure of nanocomposites. Since nanocomposites indicate the microstructure length characteristics as compared to the critical length scale, they provide the optical and mechanical aspects for every modification in their integrity. Because the XRD curves prepare a wide spectrum of data about the phase composition to crystallite size and lattice strain to crystallographic orientation, the crystalline nature and phase purity of synthesized NMOF nanocomposite were evaluated using the XRD technique. The XRD patterns of NMOF nanocomposite strongly indicated the formation of NMOF (Fig. 2). As demonstrated, the diffraction peaks at 17.189°, 25.035°, 27.726°, 29.529°, and 39.530° are indicative of crystal structure in NMOF nanocomposite. On the other hand, the XRD pattern of CS shows diffraction peaks at 2θ = 10.980° to 67.576° whereas the visible diffraction peaks at 17.278° to 27.730° are observed for NMOF-CS nanocomposite30. For the NMOF-CS-FA-D sample, the sharp diffraction peaks at 2θ = 25.362° to 29.451° are related to FA conjugation to NMOF-CS and the presence of FA in the structure of nanocomposite. Moreover, the decrease in the diffraction peaks of DOX-loaded NMOFs could be attributed to the successful trapping of the DOX which resulted in the decreased X-ray contrast between the porous framework and pore cages; therefore, these results extremely reveal the amorphous statues of DOX molecules in the NMOF and crystalline structure of nanocomposite31.
The XRD patterns before and after DOX loading in NMOF, NMOF-CS and NMOF-CS-FA-D nanocomposites. The diffraction peaks at 17.189°, 25.035°, 27.726°, 29.529°, and 39.530° are presenting the crystal structure in NMOF nanocomposite. Decreasing the diffraction peaks of DOX-loaded NMOFs are due to the successful trapping of the DOX and crystalline structure of nanocomposite.
Size and morphology analysis
The DLS technique was utilized for the evaluation of the size and PDI of NMOF and NMOF-CS-FA-D nanocomposites. The nanoparticle size has been playing a momentous impact on using drug dosage. Moreover, the physical stability of nanocomposite in human body serum is directly attributed to its size and therapeutic efficiency of the nanoparticle such as escaping from in vivo barriers that could effectively be affected by the size of nanocomposite32. On the other hand, the kind of solvent and preparation method is an important issue in the size of NMOF-based porous compartments. The hydrodynamic size of the NMOF and NMOF-CS-FA-D nanocomposites was attained at about 66.4 nm (PDI: 0.12) and 181 nm (PDI: 0.15) in diameter, respectively. The zeta potential of NMOF-CS-FA-D is reduced to 8 ± 2 mV. The FA conjugation neutralize the most of amin groups in chitosan layer of nanocomposite. The drug loading and CS-FA-modified surface of NMOF could be a result of size growth in NMOF-CS-FA-D. Besides, DOX could firm the hydrogen bond with the core of NMOF-CS-FA and further enhance the size of the nanocomposite. The size and morphology determination of nanocomposites was implemented with a microscopic approach such as TEM and SEM (Fig. 3). The TEM images indicated the unique globular morphology with a size less than 50 nm and 80 nm for NMOF and NMOF-CS-FA-D, respectively. Uneven loading of DOX and coating of CS-FA enhanced the size of the synthesized NMOFs along with great size variation32. The gelatinous layers around the globular nanocomposites are assigned to CS-FA which covered the NMOF. On the other hand, the SEM images NMOF and NMOF-CS-FA-D demonstrate the size from 50 to 100 nm and globular, semispherical, and step-like shape and morphology. The step-like shape can be due to using lyophilized samples for imaging. The microscopic results are slightly smaller in size than the DLS technique may be due to the monodisperse preparation of specimens before imaging. Additionally, the lack of distinguishing discrepancies in the surface morphology of drug-loaded nanocomposite could be owing to drug loading in NMOF32.
The SEM (A and B) and TEM (C and D) images of NMOF (A and C) and NMOF-CS-FA-D (B and D) nanocomposites. The TEM images indicated the unique globular morphology with a size less than 50 nm and 80 nm for NMOF and NMOF-CS-FA-D, respectively. The SEM images are demonstrating the size from 50 to 100 nm and globular, semispherical, and step-like shape and morphology for synthetics.
Drug loading efficiency and release profile
The drug loading efficiency (DLE) of DOX, as a chemotherapeutic agent, in NMOF nanocomposite was calculated using standard curves to assess its drug loading potency and release behavior. This value was attained at 72 ± 5% which is a high amount for nanoparticle-based compartments. This high drug loading is directly attributed to the porous structure of NMOF and CS chains which covered the surface of nanocomposite and provided further opportunities for forming various interactions with DOX33. The release profile of NMOF-CS-FA-D nanocomposite under pH values of 7.4 and 5.0 is exhibited in Fig. 4. As it showed, there is the initial burst DOX release for nanocomposites at the first time of release which is owing to drug entrapment on the near of CS-coated NMOF and NMOF surface which is physically absorbed. More than 50% of the drug has been released in the first 10 h at pH 7.4. In comparison to the release profile at pH 7.4, the nanocomposites have demonstrated fast DOX release at pH 5.0 at all times due to the protonation of amino groups in CS chains. These results exhibit that DOX in the acidic environment of cancer cells, especially intracellular endosomes that have low pH, could be released at high speed which is appropriate for effective cancer cell growth inhibition18,22. For the drug release manner of the nanocomposite, various intermolecular and intramolecular interactions such as the covalent, hydrogen-bonding, π-π interactions, and electrostatic (the most important factor) could be involved. The pH of the environment is another determining factor of drug release in the human body and target cells since acidic pH could lead to protonation of the CS chain in NMOF nanocomposite and effectively affect the interaction of DOX with nanocomposite33,34. The protonation can be created in the amino groups of CS chains that coat the surface of NMOF.
The drug release profile of NMOF-CS-FA-D nanocomposite under pH values of 7.4 and 5.0. NMOF-CS-FA-D show a controlled release manner at pH 7.4 than pH 5.0. The protonation of the CS chain at pH 5.0 is the main reason for the fast rate of DOX release which is an appropriate issue for the effective delivery of DOX to cancer cells since their environment is acidic.
Cell viability assay
The cytotoxic performance and cancer cell growth inhibition potency of NMOF-CS, NMOF-CS-D, NMOF-CS-FA, and NMOF-CS-FA-D specimens was scrutinized by carrying out the MTT tests (Fig. 5). This assay in the presence of different concentrations of samples, including 5 µg/mL, 10 µg/mL, 20 µg/mL, and 40 µg/mL, was evaluated on the breast cancer MCF-7 cells and human normal HFF1 cell line at 24 h, and 48 h, and 72 h of post-treatment. Generally speaking, the outputs state the presence of a linear correlation between the concentration of DOX-containing samples with their toxic effect on the examined cancer cell line. As can be seen in Fig. 5, noticeable cytotoxicity was observed for the NMOF-CS-FA-D sample after 24 h at 20 µg/mL (27.17 ± 5.83% cell viability) and 40 µg/mL (17.39% ± 6.34 cell viability) concentrations, respectively, which containing chemotherapeutic agents. The cell viability values were 80.1 ± 4.87% and 80.7 ± 4.25% for NMOF-CS-FA-D and NMOF-CS-FA samples for 40 µg/mL after 24 h of post-treatment on a normal cell line. Generally speaking, the FA-targeted and drug-loaded nanocomposites had no remarkable cell toxicity on HFF1 normal cell lines which can be owing to a lack of FA receptor overexpression and subsequently, introduce this nanocomposite as an appropriate candidate for drug delivery goals in the human body. By increasing the concentration of NMOF-CS-FA nanocomposite, its cytotoxic effect strongly enhanced in cancer cells that is due to the FA receptor-mediated internalization of NMOF which, in turn, leads to a high level of NMOF cellular uptake and considerable cytotoxicity. Besides, NMOF-CS indicated very low toxicity in cancer and normal cell lines which further approves the biocompatibility and biodegradability of CS-coated nanocomposite19. FA owing to its receptor overexpression on the surface of cancer cells such as breast cancer has an excellent potency for targeted drug delivery35. Moreover, the higher cytotoxic capability of the NMOF-CS-FA-D nanocarrier can be owing to the stable structure of NMOF-CS-FA, which guarantees the controlled drug release during a specific period and suitable biocompatibility of nanocomposite which additionally enhances its cellular internalization39. On the other hand, the 50% maximal inhibitory concentration (IC50) of NMOF-CS-FA-D is 5 µg/mL for 24 h of post-treatment (Fig. 5A) and 10 µg/mL for 48 h and 72 h of post-treatment in the MCF-7 cell line (Figs. S1A and S2A) whereas any IC50 is detected for HFF1 at the same conditions which potentially verifies the biosafety and biocompatibility of synthesized nanocomposite for normal cells for 24 h, 48 h and 72 h (Figs. 5B, S1B and S2B). These results were in line with the cell viability findings of Zhang et al.40 in which they used NMOF for co-delivery of DOX and verapamil. In comparison to research work by Shi et al.36, deoxycholic acid-, PEG-, and FA-modified CS nanoparticles were applied to target the delivery of DOX to HeLa cells. Their cell viability data have indicated more toxic effects on cancer cells only in 40 µg/mL concentration which is a higher concentration than ours. Moreover, our main sample (NMOF-CS-FA-D) demonstrated potential cytotoxicity in all concentrations (5 µg/mL, 10 µg/mL, 20 µg/mL, and 40 µg/mL) which shows the potential capability of our nano-complex in suppressing cancer cells. Furthermore, in another work conducted by Abazari et al.37, DOX-loaded CS/Bio-MOF nanocomposite was developed for pH-sensitive drug delivery against breast cancer MCF-7 cells. The IC50 value was determined at about 3.125 µg/mL concentration for their synthetics which is relatively consistent with our findings in inhibiting breast cancer cells. Also, significant biocompatibility of CS-MOF nanocomposite was exhibited in their research like our data.
Effects of NMOF-CS, NMOF-CS-D, NMOF-CS-FA, and NMOF-CS-FA-D nanocomposites on cell viability of MCF-7 (A) and HFF1 (B) cell lines after treatment with various concentration of nanocomposites at 24 h of post-treatment. The excellent cell growth inhibition potency is obtained for NMOF-CS-FA-D, especially on MCF-7 cells, at all concentrations and treatment times (IC50: 5 µg/mL). Less cytotoxicity is attained for NMOF-CS which is indicating excellent biocompatibility and biodegradability of the nanocarrier. P-value < 0.01 was considered statistically significant between nanocomposites and mimics.
Gene expression assay
The qRT-PCR was applied to investigate the relative expression level of apoptotic and autophagy genes, including Caspase-9, BAX, BECLIN1, and ATG5 after 5 h of treatment with 40 µg/mL of NMOF-CS-FA-D nanocomposite in MCF-7 cell line (Fig. 6). DOX-containing nanocarrier can strongly utilize for inhibition of cancer cell growth in various carcinomas such as breast, stomach, ovarian, acute lymphoblastic leukemia, brain, lung, and so forth24. NMOF could considerably eliminate the side effects of DOX on normal cell lines of the human body and by its receptor-mediated targeting of cancer cells can suppress cell division and cell invasion in different cancers, cause cell apoptosis, and suppress cancer cell cycle by preventing DNA replication, blocking the topoisomerase II enzyme. Consequently, these actions induce apoptotic and autophagy gene expression in cancer cells38. Figure 6 has been demonstrating the significant alterations in Caspase-9, BAX, BECLIN1, and ATG5 gene expression levels. Their relative expression levels are increased by more than 2, 4, 2, and 2 folds in comparison to the control sample after treatment with NMOF-CS-FA-D, respectively. Meanwhile, NMOF-CS-FA-treated MCF-7 cells do not show a high level of apoptotic and autophagy expression (approximately as same value as control) in comparison to NMOF-CS-FA-D which is indicative of biocompatibility and biodegradability of the synthesized nanocarrier. These data have been verifying the remarkable potency of the DOX-loaded nanocomposite in inducing apoptotic (Caspase-9 and BAX) and autophagy (BECLIN1 and ATG5) genes in breast cancer cells and further reveal the potency of NMOF as an effective DDS. BECLIN1 is a determining factor in the localization of autophagy proteins at autophagic vesicles and its expression in cancer cells is positively attributed to the expression of apoptotic genes such as Caspase-9 which, in turn, leads to overexpression of BECLIN1 and as well as metastatic genes39,40. Our data for apoptotic gene expressions were in line with the findings of Abd-Elhakeem et al.25, which developed a DOX-loaded CS-protamine nano-complex for the suppression of breast cancer cells. Their results indicated approximately two-fold changes in the expression of apoptotic genes after treatment with IC50 concentrations of DOX-CS-protamine nanocomposite. On the other hand, our data are the following outputs of research by Zhang et al.41, in which CS oligosaccharides were used for the potential delivery of DOX to H9C2 cells. Based on their findings, the expression values of Caspase-9, Caspase-3, and BAX were increased by relatively 1.5, 2, and 1.3 folds in target cells which reveal the ability of CS-based drug delivery systems to induce apoptosis and autophagy.
The expression level of apoptotic and autophagy genes, including Caspase-9, BAX, BECLIN1, and ATG5 after 5 h of treatment with 40 µg/mL of NMOF-CS-FA-D nanocomposite in MCF-7 cell line. The results are indicating that NMOF-CS-FA-D leads to overexpression of BAX (more than 4 folds in comparison to control) and Caspase-9 (nearly 2 folds in comparison to control) genes followed by overexpression of BECLIN1 and ATG5 genes. P-value < 0.0001 was considered statistically significant between nanocomposites and mimics.
Cell cycle analysis
A flow cytometer was utilized to scrutinize the cell cycle analysis. In this experiment, MCF-7 cells were seeded in a 6-well plate and incubated with 40 µg/mL of NMOF-CS-FA-D for 24 h. The results of this test significantly demonstrate the effect of DOX-containing NMOF-CS-FA on cell viability and cell proliferation (Fig. 7). According to this assessment, the proportion of breast cancer MCF-7 cells in the sub-G1 phase is about 14.4% after treatment with NMOF-CS-FA-D nanocomposite which significantly greater than that in cells treated with NMOF-CS-FA (9.06%) and control group (3.02%). The entering of the cell in the sub-G1 phase is the indicative of apoptotic phase in cancer cells. These results present good biocompatibility of NMOF-CS-FA and additionally introduce NMOF-CS-FA-D as an excellent candidate for effective DOX delivery34. FA-mediated cancer-targeting via NMOF-CS-FA-D can cause cell apoptosis, and cell cycle arrest, and subsequently suppresses cell division and cell invasion38. On the other hand, more than 90% of the cells are in the G1, S, and G2 phases of the cell cycle after treatment with NMOF-CS-FA which approves great biocompatibility and biodegradability for the synthetic nano-composite with a very low side effect. Also, the higher cell cycle arrest capability of NMOF-CS-FA-D is attributed to the better internalization and transfection of the nanocarrier which is due to FA receptor targeting23,34. The outputs of our research are consistent with the findings of Abd-Elhakeem et al.25 in arresting MDA-MB-231 breast cancer cells using DOX-loaded CS-protamine nanoparticles. They showed cell cycle arrest in cancer cells after 48 h of treatment with 3 μM concentrations of DOX-containing nano-complex. Their used concentration is higher than the used values in our research which could be due to using an effective targeting agent (FA) in our nano-complex. Additionally, in another work performed by Nogueira-Librelotto et al.42, DOX-loaded pH-sensitive CS-tripolyphosphate nanoparticles were applied to inhibit the cell cycle in cervical HeLa tumor cells. Their data has indicated a considerable cell cycle arrest in acidic pH than normal pH due to its pH sensitivity which is in line with our results.
Effect of NMOF-CS-FA-D (A), NMOF-CS-FA (B), and non-specific control (C) on the cell cycle analysis of MCF-7 cancer cells. The cell cycle analysis was implemented using a flow cytometer to further evaluate the potency of nanocomposite as an effective DDS. The results show that NMOF-CS-FA-D remarkably enhanced the proportion of cancer cells in the sub-G1 phase (14.4%). P-value < 0.01 was considered statistically significant between nanocomposites and mimics.
Cell apoptosis analysis
This experiment was carried out by flow cytometer which is a significant approach to evaluating the apoptosis-inducing potency of NMOF-CS-FA-D nanocomposite. This test is based on the fragmentation of cancer cell DNA. The early apoptosis, late apoptosis, and necrosis values of breast cancer cells treated with 40 µg/mL of the nanocomposite demonstrated great therapeutic performance (Fig. 8). Based on the data, the MCF-7 cancer cells subjected to NMOF-CS-FA-D nanocomposite show 14.3% of late apoptosis whereas it is just 7.45% and 3.53% for NMOF-CS-FA and control, respectively. Meanwhile, the early apoptosis values observed at 17.6%, 4.27%, and 2.02% for NMOF-CS-FA-D, NMOF-CS-FA, and the control group, respectively, which additionally approve the apoptosis-inducing capability of DOX-containing targeted NMOF and triggering autophagy process in cancer cells. These high amounts of apoptosis can be due to FA-receptor-targeted DOX delivery that is indicative of tumor cell inhibition performance of synthetic nanocomposite. The apoptosis results of our work are in line with a work by Nei et al.43 in which the was applied MnO2/DOX@DZ nanocomposite as NMOF for cancer cell inhibition. Moreover, in comparison to Abd-Elhakeem et al.25 research in which their DOX-loaded CS-protamine nanoparticles led to about 26% apoptosis (early + late) in breast cancer cells, our NMOF-CS-FA-D nano-complex indicated nearly 30% apoptosis which is better than their synthetics. On the other hand, 50% of apoptosis has been indicated for CS-PEG-DOX synthetics after 24 h treatment with 2 μg/mL in research conducted by Nogueira-Librelotto et al.42,44 which is a considerably high value. Of course, their concentration was higher than ours in this test.
Effect of NMOF-CS-FA-D (A), NMOF-CS-FA (B), and non-specific control (C) on the apoptosis analysis of MCF-7 cancer cells. The cell apoptosis assay was carried out by applying a flow cytometer via Annexin V-FITC/PI staining. According to the results of NMOF-CS-FA-D treated cancer cells, the value of inducing late apoptosis is 14.3% whereas it is 3.53% for control which reveals the substantial potency of synthesized NMOF in inhibition of cancer cell growth. P-value < 0.01 was considered statistically significant between nanocomposites and mimics.
Conclusion
In this research work, a straightforward synthetic procedure was applied for the synthesis of NMOF-CS-FA as a novel nanocomposite for effective drug delivery. Then, DOX as a chemotherapeutic agent was used and loaded into the above-mentioned nanocarrier, and the high value of drug loading was calculated for porous structure nanocomposite. Afterward, the drug release profile of the prepared nanocomposite was investigated in an acidic and neutral medium which approved its controlled release performance. These results indicated that surface modification of the NMOF by CS-FA allows a higher DOX loading and release especially in acidic conditions that are indicative of the cancer cell environment. In continuation of the in vitro studies, the cell viability, relative expression of apoptosis and autophagy genes, cell cycle arrest, and apoptosis test were performed to scrutinize MCF-7 breast cancer cell growth inhibition potency of NMOF-CS-FA-D. These analyses have potentially verified the capability of synthesized nanocomposite in inhibition of breast cancer cell growth and inducing cell apoptosis suggesting NMOF-CS-FA-D as a promising nanocarrier for breast cancer therapy.
Data availability
The data that support the findings of this study are available on request from the corresponding author.
References
Sung, H. et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 71(3), 209–249 (2021).
Boero, I. J. et al. The impact of surgeons on the likelihood of mastectomy in breast cancer. Ann. Surg. 269(5), 951–958 (2019).
Santiago-Gómez, A. et al. PAK4 regulates stemness and progression in endocrine resistant ER-positive metastatic breast cancer. Cancer Lett. 458, 66–75 (2019).
Zeng, Y. et al. Metal-organic framework-based hydrogel with structurally dynamic properties as a stimuli-responsive localized drug delivery system for cancer therapy. Acta Biomater. 145, 43–51 (2022).
Ding, S. et al. Overcoming blood–brain barrier transport: Advances in nanoparticle-based drug delivery strategies. Mater. Today 37, 112–125 (2020).
Yousefi, M., Narmani, A. & Jafari, S. M. Dendrimers as efficient nanocarriers for the protection and delivery of bioactive phytochemicals. Adv. Coll. Interface. Sci. 278, 102125 (2020).
Kumari, R., Sunil, D. & Ningthoujam, R. S. Hypoxia-responsive nanoparticle based drug delivery systems in cancer therapy: An up-to-date review. J. Control. Release 319, 135–156 (2020).
Alves, R. C. et al. Folic acid-conjugated curcumin-loaded bioMOF-101 for breast cancer therapy. J. Drug Deliv. Sci. Technol. 86, 104702 (2023).
Wu, M. X. & Yang, Y. W. Metal–organic framework (MOF)-based drug/cargo delivery and cancer therapy. Adv. Mater. 29(23), 1606134 (2017).
He, C. et al. Nanoscale metal–organic frameworks for the co-delivery of cisplatin and pooled siRNAs to enhance therapeutic efficacy in drug-resistant ovarian cancer cells. J. Am. Chem. Soc. 136(14), 5181–5184 (2014).
Li, H. et al. Composite CD-MOF nanocrystals-containing microspheres for sustained drug delivery. Nanoscale 9(22), 7454–7463 (2017).
Malekian, M. et al. Development of novel chimeric endolysin conjugated with chitosan-Zn-metal–organic framework nanocomposites with antibacterial activity. Appl. Biochem. Biotechnol. 196(2), 616–631 (2024).
Doonan, C. et al. Metal–organic frameworks at the biointerface: Synthetic strategies and applications. Accounts Chem. Res. 50(6), 1423–1432 (2017).
Rojas, S., Devic, T. & Horcajada, P. Metal organic frameworks based on bioactive components. J. Mater. Chem. B 5(14), 2560–2573 (2017).
Rezvani, M. et al. Synthesis and in vitro study of modified chitosan-polycaprolactam nanocomplex as delivery system. Int. J. Biol. Macromol. 113, 1287–1293 (2018).
Chen, Y. et al. Evaluation of the PEG density in the PEGylated chitosan nanoparticles as a drug carrier for curcumin and mitoxantrone. Nanomaterials 8(7), 486 (2018).
Amgoth, C. et al. Metal (Au)-decorated chitosan-L-arginine polymeric vector for codelivery of gefitinib and miR125b for lung cancer therapy. ACS Appl. Polym. Mater. 4(3), 1675–1687 (2022).
Mokri, N. et al. Chitosan-coated Zn-metal-organic framework nanocomposites for effective targeted delivery of LNA-antisense miR-224 to colon tumor: In vitro studies. Gene Therapy 29(12), 680–690 (2022).
Zamanvaziri, A. et al. Targeted PEGylated chitosan nano-complex for delivery of sodium butyrate to prostate cancer: An in vitro study. Technol. Cancer Res. Treat. 22, 15330338231159224 (2023).
Wang, B. et al. Effects of hydrophobic and hydrophilic modifications on gene delivery of amphiphilic chitosan based nanocarriers. Biomaterials 32(20), 4630–4638 (2011).
Parsaei, M. & Akhbari, K. Synthesis and application of MOF-808 decorated with folic acid-conjugated chitosan as a strong nanocarrier for the targeted drug delivery of quercetin. Inorg. Chem. 61(48), 19354–19368 (2022).
Khatibi, Z., Kazemi, N. M. & Khaleghi, S. Targeted and biocompatible NMOF as efficient nanocomposite for delivery of methotrexate to colon cancer cells. J. Drug Deliv. Sci. Technol. 73, 103441 (2022).
Golafzani, F. N. et al. Delivery of miRNA-126 through folic acid-targeted biocompatible polymeric nanoparticles for effective lung cancer therapy. J. Bioactive Compatible Polym. 37(3), 168–188 (2022).
Tacar, O., Sriamornsak, P. & Dass, C. R. Doxorubicin: An update on anticancer molecular action, toxicity and novel drug delivery systems. J. Pharm. Pharmacol. 65(2), 157–170 (2013).
Abdel-Hakeem, M. A. et al. Doxorubicin loaded on chitosan-protamine nanoparticles triggers apoptosis via downregulating Bcl-2 in breast cancer cells. J. Drug Deliv. Sci. Technol. 55, 101423 (2020).
Zeng, X. et al. Enhancement of doxorubicin cytotoxicity of human cancer cells by tyrosine kinase inhibition of insulin receptor and type I IGF receptor. Breast Cancer Res. Treat. 133, 117–126 (2012).
Lin, K. et al. Combination of ruthenium complex and doxorubicin synergistically inhibits cancer cell growth by down-regulating PI3K/AKT signaling pathway. Front. Oncol. 10, 141 (2020).
Khan, I. et al. Nano-co-delivery of berberine and anticancer drug using PLGA nanoparticles: Exploration of better anticancer activity and in vivo kinetics. Pharmaceut. Res. 36, 1–17 (2019).
Li, J.-M. et al. Reversal of multidrug resistance in MCF-7/Adr cells by codelivery of doxorubicin and BCL2 siRNA using a folic acid-conjugated polyethylenimine hydroxypropyl-β-cyclodextrin nanocarrier. Int. J. Nanomed. 2015, 3147–3162 (2015).
Ali, M. E. A. et al. Chitosan nanoparticles extracted from shrimp shells, application for removal of Fe (II) and Mn (II) from aqueous phases. Separ. Sci. Technol. 53(18), 2870–2881 (2018).
Ghaffar, I. et al. Synthesis of chitosan coated metal organic frameworks (MOFs) for increasing vancomycin bactericidal potentials against resistant S. aureus strain. Mater. Sci. Eng. C 105, 110111 (2019).
Chalati, T. et al. Optimisation of the synthesis of MOF nanoparticles made of flexible porous iron fumarate MIL-88A. J. Mater. Chem. 21(7), 2220–2227 (2011).
Tai, S. et al. Facile preparation of UiO-66 nanoparticles with tunable sizes in a continuous flow microreactor and its application in drug delivery. Micropor. Mesopor. Mater. 220, 148–154 (2016).
Zheng, H. et al. One-pot synthesis of metal–organic frameworks with encapsulated target molecules and their applications for controlled drug delivery. J. Am. Chem. Soc. 138(3), 962–968 (2016).
Narmani, A. et al. Folic acid functionalized nanoparticles as pharmaceutical carriers in drug delivery systems. Drug Dev. Res. 80(4), 404–424 (2019).
Shi, Z. et al. Nanoparticles of deoxycholic acid, polyethylene glycol and folic acid-modified chitosan for targeted delivery of doxorubicin. J. Mater. Sci. Mater. Med. 25, 723–731 (2014).
Abazari, R. et al. Chitosan immobilization on bio-MOF nanostructures: A biocompatible pH-responsive nanocarrier for doxorubicin release on MCF-7 cell lines of human breast cancer. Inorg. Chem. 57(21), 13364–13379 (2018).
Teplensky, M. H. et al. Temperature treatment of highly porous zirconium-containing metal–organic frameworks extends drug delivery release. J. Am. Chem. Soc. 139(22), 7522–7532 (2017).
Zou, M. et al. Beclin 1-mediated autophagy in hepatocellular carcinoma cells: Implication in anticancer efficiency of oroxylin A via inhibition of mTOR signaling. Cell. Signal. 24(8), 1722–1732 (2012).
Wu, J. et al. MicroRNA-34a inhibits migration and invasion of colon cancer cells via targeting to Fra-1. Carcinogenesis 33(3), 519–528 (2012).
Zhang, Y. et al. Chitosan oligosaccharides prevent doxorubicin-induced oxidative stress and cardiac apoptosis through activating p38 and JNK MAPK mediated Nrf2/ARE pathway. Chem.-Biol. Interact. 305, 54–65 (2019).
Nogueira-Librelotto, D. R. et al. pH-Sensitive chitosan-tripolyphosphate nanoparticles increase doxorubicin-induced growth inhibition of cervical HeLa tumor cells by apoptosis and cell cycle modulation. Colloids Surfaces B: Biointerfaces 190, 110897 (2020).
Nie, Y. et al. Metal organic framework coated MnO2 nanosheets delivering doxorubicin and self-activated DNAzyme for chemo-gene combinatorial treatment of cancer. Int. J. Pharmaceut. 585, 119513 (2020).
Luo, H. et al. pH-sensitive stimulus responsive ZIF-8 composites nanoparticles coated with folic acid-conjugated chitosan for targeted delivery of curcumin. J. Cluster Sci. 35(5), 1533–1547 (2024).
Funding
There is no funding/support for this project. All of the materials were provided personally.
Author information
Authors and Affiliations
Contributions
Parinaz Fereydouni, Arash Al Mohaddesin: Study concept and design, Acquisition of data, Drafting of the manuscript. Sepideh Khaleghi: Critical revision of the manuscript for important intellectual content, Statistical analysis, Administrative, technical and material support, Study supervision, Analysis, and interpretation of data. The authors declare that they have consent to participate. The authors declare that they have consent to publish.
Corresponding author
Ethics declarations
Competing interests
The authors declare no competing interests.
Additional information
Publisher's note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Information
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
About this article
Cite this article
Fereydouni, P., Al Mohaddesin, A. & Khaleghi, S. Targeted biocompatible Zn-metal–organic framework nanocomposites for intelligent chemotherapy of breast cancer cells. Sci Rep 14, 18311 (2024). https://doi.org/10.1038/s41598-024-69457-6
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41598-024-69457-6
- Springer Nature Limited