Introduction

Bagaza virus (BAGV) is a positive-sense, single-stranded RNA virus belonging to the mosquito-borne cluster of the genus Orthoflavivirus, family Flaviviridae of the Ntaya serocomplex, along with Tembusu virus (TMUV)and Israel turkey meningoencephalitis virus (ITV)1. BAGV shares high sequence similarity with ITV, alt-hough they are still classified as two distinct species by the International Committee on Taxonomy of Viruses (ICTV2022). As other viruses from the Ntaya and JE serocomplexes, BAGV is maintained in nature in transmission cycles involving viremic wild bird reservoirs and Culex spp. mosquitoes.

BAGV was first isolated in 1966 from a pool of Culex mosquitoes collected in the Bagaza district of the Central African Republic2. It was later detected in several species of Culex in other geographic areas, namely Cx. tritaeniorhynchus in India3, Aedes fowleri, Cx. neavei and Cx. poicilipes in Mauritania, Senegal and Cameroon4, Cx. perexiguus in the United Arab Emirates5 and Cx. univittatus in Namibia6. In vertebrate hosts, BAGV was first detected in red-legged partridges (Alectoris rufa) and in ring-necked pheasants (Phasianus colchicus) in Spain, in 20107, and a few years later, in 2016, in the Himalayan monal (Lophophorus impejanus) in South Africa8. More than a decade after its detection in Spain, BAGV was diagnosed in several partridges from southern Portugal in September 2021, and in one corn bunting (Emberiza calandra) during the transmission season (late summer)9.

BAGV infection causes neurological signs in several bird species, mainly in red-legged partridge and common pheasant, but also in common wood pigeon (Columba palumbus)7,9,10,11. Mortality rates of 23% and 6% were described for par-tridges and pheasants, respectively12.

Serological evidence shows that BAGV is able to infect humans3, like other viruses from the Ntaya serocomplex and the JE serocomplex, although its pathogenicity is still unclear.

In recent years, an increasing number of outbreaks of the zoonotic viruses in the Nataya serocomplex have been recorded, posing a threat to animal and human health13. Surveillance programmes and opportunistic sampling in areas where mortality events have occurred provide important information for risk analysis. Here we report the detection and characterization of BAGV by molecular techniques in carcasses of Eurasian magpies (Pica pica).

Materials and methods

Ethical declaration

The study only used animals found dead in the field. No animals were killed or manipulated alive for sample collection. The animals were collected as part of the routine of the National Reference Laboratory for Animal Health (INIAV, I.P.) and laboratorial investigations were carried out under BSL-3 conditions.

Necropsy and virological analysis

In mid-September 2023, seven common magpies (Eurasian magpies) were found dead in a 150 m2 hunting area in the district of Mariola, southern Portugal.

During necropsy, kidney, spleen, heart and feather follicles were collected from the tree magpies. For nucleic acid extraction, homogenates were prepared with kidney, heart, spleen and feather follicle samples from each of the three birds (4 pools), homogenised at 20% (w/v) with phosphate saline buffer and clarified at 3000 g for 5 min at 4 °C. Total RNA was extracted from 200 µL of the three clarified supernatants (heart, spleen and kidney) using the India Pathogen Kit (Indicial, Leipzig, Germany) and the nucleic acid extraction workstation Kingfishers Flex (Thermosphere Scientific, MA, USA), according to the manufacturer's instructions. For nucleic acid extraction from the feather follicles a user-developed protocol14 from the DNeasy Tissue Protocol (DNeasy® Blood & Tissue Kit, Qiagen, Germany) was used.

Positive (VLP-RNA Extraction Control ORA, Meridian Bioscience, OH, USA and 18S rRNA15) and negative controls for nucleic acid extraction were included to validate the procedure.

The supernatant of the homogenates obtained after centrifugation were filtered through a 0.45-µm-pore-size filter (Millipore Express, Darmstad, Germany) and used to inoculate sub confluent (70%) BHK-21 cells and C6/36 cells, grown in Eagle’s (Gibco) and MEM (Gibco) medium, respectively. Medium was supplemented with 10% FBS, penicillin, streptomycin and amphotericin B (antibiotic-antimycotic used at 1:100, Gibco) and 50 µg/mL gentamicin (Gibco). Cells were maintained at 37 °C (BHK21) and 28 °C (C6/36), in a humidified atmosphere with 5% CO2 and observed daily for cytopathic effect (CPE) by phase-contrast microscopy.

The presence of BAGV-RNA was tested by RT-qPCR, with the primers and conditions previously reported by other authors16. Usutu virus, West Nile virus, Avian influenza virus and Avian paramyxovirus type 1 were also investigated by molecular methods, as previously described by other authors17,18,19,20. Positive and negative controls were included for RT-qPCR validation.

A fragment targeting the NS1 gene (from feather follicles sample) was obtained with primers BAGV-815F (5' GAGAATTGGGCCATACGTAACC 3') and 1197R (5' GCTTTGGTGTTGTGGGCCT 3'). The RT-PCR reactions were performed using the AgPath-ID™ One-Step RT-PCR Reagents Kit (Applied Biosystems, MA, USA) according to the manufacturer's recommended conditions at an annealing temperature of 55°C. Amplicons were run on a 1.5% agarose gel, purified with NZYGelpure (NZYTech, Lisbon, Portugal) and cloned into plasmid pJET1.2 (CloneJET PCR Cloning Kit, Thermo Scientific™, MA, USA). Inserts were sequenced with primers referred above and primers BAGV-952R (5' GCAATTGAAGCTGTAGGCCG 3') and 992F (5' GGAGTTGAGTGGATTGATGTT 3') using the ABI Prism BigDye Terminator v3.1 Cycle sequencing kit on a 3130 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). Primers were designed in this study based on sequence BAGV/PT/2021 (LC730845).

Results

Four of the seven animals showed severe skeletal reduction hampering any sampling.

Necropsy of the three remaining magpies showed signs of predation and some degree of autolysis, which hampered histopathological examination. Due to the poor condition of the birds, organs were pooled for nucleic acid extraction.

Results of virology tests obtained by real-time RT-PCR are shown in Table 1. The magpies were negative for WNV, USUV, AI and APMV-1 and positive for BAGV in the kidney (Ct 36.68) and spleen (Ct 38.71) homogenates. Feather follicles also tested positive with a slightly lower Ct value of 35.08. Bagaza virus RNA was not detected in the heart homogenate. The poor condition of the samples may explain the high Ct values due to RNA degradation. Agarose gel electrophoresis of the real time RT-PCR products, revealed the presence of amplicons of approximately 100 bp in the spleen, kidney and follicles’ pools, as well as in PCR positive control.

Table 1 Results of the molecular detection of viral pathogens (West Nile virus (WNV), USUTU virus (USUV), Avian influenza virus (AIV), Avian paramyxovirus serotype 1 (APMV-1) and Bagaza virus (BAGV)) under investigation.
Full size table

To further confirm the molecular detection of BAGV (based on the NS5 gene), a 342 bp region within the NS1 gene was successfully amplified from the feather follicle pool as described above and submitted to GenBank and assigned accession number PP130723. This sequence showed 99.71% similarity with BAGV isolated from Portugal (LC730845) and Spain (OR472392) corresponding to silent point mutations and 84.80–99.12% similarity with the homologous sequences of other BAGVs available in databases, suggesting the circulation of related strains in the Iberian Peninsula. This partial NS1 gene sequence was used in a phylogenetic analysis (Fig. 1) showing the close relationship with previous Bagaza virus isolated from other birds in Portugal and Spain.

Figure 1
figure 1

Phylogenetic analysis based on 35 partial nucleic acid sequences of Orthoflaviruses isolated in invertebrate and vertebrate species. The access number of the nucleotide sequences are given. The evolutionary history was inferred by using the Maximum Likelihood method and Kimura 2-parameter model21. The tree with the highest log likelihood (− 1798.33) is shown. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. Only bootstrap values higher than 70 are shown. The evolutionary analyses were conducted in MEGA22. The icons shown represent mosquitoes (Culex species), turkeys, Eurasian magpie, pheasant, red grouse and ducks.

Full size image

Virus isolation was unsuccessful after 6 passages in BHK-21 and in C6/36 cells. No CPE was observed in the infected cell cultures, nor did the real-time RT-PCR developed by other authors13 give positive results when testing the cell supernatants.

Discussion and conclusions

The common magpie (Pica pica), a resident breeding bird native to the northern part of the Eurasian continent and belonging to the family Corvidae, is very common in Portugal, as in the whole of Europe23. It has a generalist, omnivorous diet that includes young birds, eggs, insects, grains, seeds, fruits and small mammals such as rats. As scavengers, magpies also feed on dead animals.

Common magpie was found to be highly susceptible to WNV infection24, constituting therefore a perfect sentinel species for WNV surveillance programs, both in endemic as in non-endemic areas25. However, in our study, none of the birds tested were positive for USUV or WNV. The potential susceptibility of common magpies to BAGV infection raises concerns for other susceptible species, in particular the threatened red-legged partridge, which is highly susceptible to this infection, and has already been reported positive for BAGV in the Mértola district in 20218.

Here we report for the first time the infection of Eurasian magpies (Pica pica) with BAGV. To our knowledge, evidence for the susceptibility of this species to BAGV infection was limited to serological data from only one bird, which tested weak positive for BAGV antibodies by SNT with a titer of 3025. Given the frequency of cross-reaction between different flaviviruses this serological evidence constituted a potential indication rather than conclusive proof of active BAGV infection in the mentioned species.

Two weeks earlier, a red-legged partridge in a state of cachexia was found in the surrounding area and BAGV was detected at our laboratory with a very low viral load (results not shown). At the same site, an abrupt decline in the partridge population was reported in the month before the seven carcasses were found. Despite the detection of BAGV RNA (genes NS1 and NS5) in several organ pools of the three magpies investigated in this study, no conclusion can be drawn as to the role of BAGV in the death of the birds, as anatomohistopathological examination was not possible and epidemiological information was very limited. Infection of magpies by BAGV may have occurred via mosquito bites, but also through ingestion of infected dead birds, such as partridges and magpies, due to the scavenging habits of this species. Indeed, experimental oral infection of ducklings with TMUV, in the same serogroup as BAGV, confirmed the success of this route for flavivirus infection26.

Apart from red-legged partridges, ring-necked pheasants, Himalayan monals and common wood pigeons, BAGV had not been described in other vertebrates and little was known about the role of wild birds as reservoir species to maintain virus sources for transmissions. The recognition of this presumed outbreak of BAGV in common magpies has helped to expand the known range of affected birds, allowing for a better understanding of the epidemiology of this disease.

The municipality of Mértola is considered the hunting capital of Portugal, as it is traditionally a region where small game species such as wild rabbit and red partridge are abundant. In Portugal, the magpie is a game species, with hunting season for this species runs from 20 August to the end of February. The proximity of hunters to wildlife during legal hunting seasons is therefore a reality, raising public health concerns if zoonotic pathogens are detected.

In addition, climate and environmental changes, together with anthropogenic activities, have affected the distribution of insects around the world, with implications for the spread of many vector-borne diseases, such as WNV, later in the season. This change in insect activity increases the risk of disease transmission to humans, either through mosquito bites or direct contact by consumption of wild birds, as the oral route has been shown to be successful for other flaviviruses26. Understanding the prevalence, risk factors and seasonality of this disease is paramount to managing and predicting future outbreaks, and systematic surveillance is necessary to allow future outbreaks to be managed and predicted.