Table 1 Three suitable skin-targeted mRNA markers and one reference mRNA marker, their Genbank accession number, PCR primer and probe sequences and assay IDs (Applied Biosystems) with the reporter dye and the sizes of the qPCR amplified products
From: mRNA-based skin identification for forensic applications
Gene | Genbank accession number | Primer/Probe sequence (5′→3′) | Assay ID/reference | Reporter dye | Amplicon size (bp) |
|---|---|---|---|---|---|
CDSN | NM_001264.3 | –a | Hs 00169911 m1 | FAM | 79 |
LOR | NM_000427.2 | –a | Hs 0189462. s1 | FAM | 105 |
KRT9 | NM_000226.3 | –a | Hs 00413861. m1 | FAM | 94 |
ACTB(171) | NM_001101.2 | –a | 4326315E (part number) | VIC | 171 |
ACTB(74) | NM_001101.3 | Forward: tgacccagatcatgtttgag | Primer3 software | HEX | 74 |
Reverse: cgtacagggatagcacag | |||||
Probe: HEX-caccccagccatgtacg -TAMRA |