Abstract
Thermal stress triggers the breakdown of the obligate symbiosis between the cnidarian coral host and its autotrophic dinoflagellates of the family Symbiodiniaceae. This diverse family exhibits pronounced functional variation that has large implications for the survival of their coral host. In this study, we explored patterns of symbiont community composition and diversity in the coral Turbinaria reniformis, a turbid reef specialist, along a latitudinal and environmental gradient in Western Australia. Using metabarcoding of the internal transcribed spacer region 2, we explored symbiont community patterns, their environmental drivers, and potential associations with host genetic structure. Our findings reveal a predominance of Cladocopium across our study area, with distinct regional composition influenced primarily by sea surface temperature. Geographical distance and host genetic data did not align with symbiont community divergence, suggesting a complex interplay of environmental and genetic factors t shaping the community structure. This study underscores Cladocopium stability in Western Australia across large distances and strong environmental gradients. It also highlights the highly diversified lineage community that may explain T. reniformis ability to thrive in a wide range of environmental conditions.
Similar content being viewed by others
Avoid common mistakes on your manuscript.
Introduction
Coral reefs are complex ecosystems that rely on the symbiotic relationship between Scleractinia coral and the dinoflagellate Symbiodiniaceae (Falkowski et al. 1984; LaJeunesse et al. 2018; Muscatine et al. 1981). The symbiotic algae are photoautotrophs that convert sunlight and carbon dioxide into organic carbon and oxygen (Muscatine and Porter 1977; Page et al. 2019). However, rising sea surface temperatures (SST) have led to more frequent and severe coral bleaching events, resulting in the loss of their symbionts and subsequent mortality of the coral host (Baker 2003; Glynn 1984; Heron et al. 2016; Hoegh-Guldberg 1999; Hughes et al. 2003, 2017; Rowan et al. 1997). Understanding the effects of extreme environmental conditions on reef-building corals is crucial for predicting the potential impact of future ocean conditions on coral populations (Camp et al. 2018; Kleypas et al. 1999).
The diversity in both genetic and functional aspects of algal symbionts within the Symbiodiniaceae family is extensive (LaJeunesse et al. 2018) and particular coral-algae partnerships have been suggested to enhance the resilience of the coral holobiont to climate change (Berkelmans and Van Oppen 2006; Howells et al. 2011). Recent studies indicate that different genera of Symbiodiniaceae form symbiotic relationships with various coral hosts and exhibit distinct physiological attributes (e.g. enhanced growth rates, photosynthesis efficiency, thermal tolerance) across extensive latitudinal and environmental gradients (D. M. Baker et al. 2013; Chen et al. 2019; Hume et al. 2016; LaJeunesse et al. 2010, 2018; Ziegler et al. 2015). The performance and functionality of the coral holobiont is therefore, influenced by the identity and composition of its symbionts' distinct genetics and physiology (Johnston et al. 2022; Lajeunesse et al. 2014, 2018).
Investigating corals in various types of habitats such as turbid or high-latitude reefs offers a unique opportunity to uncover the mechanisms that support the ecological resilience of the coral communities persisting at extreme environmental conditions (Smith et al. 2020) Environmental factors, such as irradiance (Rowan et al. 1997), turbidity (Garren et al. 2006) and temperature (LaJeunesse et al. 2010; Tonk et al. 2013) have been linked to diversity and specificity of the coral-algal symbiosis. In extreme environments, corals hosts have been found to associate more with symbiont communities characterized by the stress tolerant Durusdinium, novel Cladocopium clades, and/or high symbiont diversity (Hennige et al. 2010; Oliver and Palumbi 2011; Smith et al. 2017; Wicks et al. 2010). Enhancing our knowledge of symbiont community structure and specific site/host associations is central to understanding how these relationships contribute to coral resilience in the face of climate change (Baker 2001; LaJeunesse et al. 2004).
The coral reefs of Western Australia (WA) span a wide latitudinal and environmental range, from tropical regions at 13̊ S to temperate waters at 35̊ S, where coral reefs owe their existence to the influential Leeuwin current, which transports warm water along the continental shelf (Cresswell and Golding 1980). However, due to the widespread and isolated nature of WA coral reefs, limited research has been conducted on the symbiotic relationships between coral hosts and their symbiont algae. As a result, current knowledge of the biogeographic patterns of coral symbiont communities across large latitudinal gradients is limited (Silverstein et al. 2011; Thomas et al. 2014, 2019).
Population genetic studies in reef coral from WA suggested that the high-latitude temperate reefs are isolated from potential recruits originating in tropical waters (Evans et al. 2019, 2021; Thomas et al. 2017). In particular, Evans et al., (2021) study on Turbinaria reniformis across a tropical-temperate transition zone, found pronounced regional genetic differentiation and isolation of high-latitude coral populations. T. reniformis, a broadcast- spawning coral species, is considered a generalist species distributed throughout the Indo-West pacific, ranging from southern to northern WA (Veron 1993). Since, rising sea temperatures threaten the future of reefs globally (Hoegh-Guldberg et al. 2007), knowledge on T. reniformis and its associated symbionts is crucial for understanding the species’ widespread geographical distribution and its ability to adapt to varying environmental drivers.
Here, we build upon the work of Evans et al. (2021) by examining the symbiont communities using metabarcoding of the internal transcribed spacer region 2 (ITS2) in T. reniformis collected from six sites along the WA coast, spanning 12 degrees of latitude and a transition from tropical to temperate waters. We hypothesised, that similar to the coral host, the symbiont community associated with T. reniformis would display strong structure and a shift in community composition along the latitudinal gradient due to the different environmental conditions and large distances between sample sites. Our main objectives were to (1) explore patterns of symbiont community composition and diversity in a single host species across a latitudinal and environmental gradient, (2) examine the effect of environmental drivers on the symbiont community assemblages, and (3) determine whether these patterns are associated with the host genetic structure.
Methods and materials
Study sites
Sampling was conducted at six sites (Evans et al. 2021), situated in three geographical areas (Fig. 1a). The four most northern sites include Balla Balla (BB: 20°38′15″S, 117°39′42″E), Dampier Archipelago (DA: 20°32′12″S, 116°46′37″E), Montebello Islands (MI: 20°31′16″S, 115°32′39″E), and Exmouth Gulf (EG: 22°17′41″S, 114°8′59″E). All falling within a similar biogeographic region known as the Pilbara, these reefs are a renowned biodiversity hotspot, particularly for fish populations (McLean et al. 2016) and filter-feeding communities (Fromont et al. 2016). Within this region, coral reefs are found along a semi-arid coastline with a natural cross-shelf turbidity gradient (Evans et al. 2020; Moustaka et al. 2018), and low light penetration at nearshore sites (Abdul Wahab et al. 2017). Additionally, the coastal waters of the Pilbara are impacted by tropical cyclones (Lough 1998) which increase turbidity and can cause physical damage to corals (Harmelin-Vivien 1994).
Moving south, Shark Bay (SB, 25°51′5″S 113°20′52″E), is a UNESCO World Heritage site, located in the sub-tropical Gascoyne region, central Western Australia. In the bay, high salinities and steep temperature gradients (19–27 °C) occur due to its shallow depths (< 20 m) and presence of barrier islands. As such, coral growth is restricted to the seaward margins of the inner embayments, which are more frequently exposed to oceanic water (Marsh 1990; O’Leary et al. 2008). Shark Bay is a transition area between temperate and tropical marine zones. As such, it encompasses a mixture of temperate and tropical species as well as endemic species to Western Australia (Wyatt et al. 2005).
The most southern site, Perth (Pe, 31°41′33″S 115°38′58″E), represents a high-latitude, offshore coral reef located in the Marmion Marine Park approximately 40 km from Perth city. Here, complex chains of reefs, coves and lagoons act as barriers, restricting water exchange between inshore and offshore waters (Pobar et al. 1992). The dominant climatic factor here is wind, which generates waves, induces water circulation and transports sand inland (Pobar et al. 1992).
Sample collection and DNA extractions
In this study we focussed on the turbid reef specialist, Turbinaria reniformis. We used samples from a recent population genetic study that explored T. reniformis host structure across a latitudinal gradient in Western Australia (Evans et al. 2021). In their study, Evans et al., (2021), identified strong geographic structure in the coral host along the coastline of Western Australia based on a panel of thousands of single nucleotide polymorphism (Fig. 1b, c). We used these samples to explore patterns of symbiont community composition and diversity, allowing us to compare host patterns observed with symbiont communities, and to provide assurances that we were focussed on a single species and gene pool for our analyses. Briefly, samples of 2 cm2 nubbins were collected on SCUBA using side cutters, from colonies at least 5 m apart to avoid clone mates but within 100 m2. Samples were preserved in 100% AR grade ethanol. DNA was extracted and purified using a Qiagen Dneasy Blood & Tissue kit (plate format) following the manufacturer’s protocol and stored in − 80 °C until further processing.
Environmental data
To detect any differences in environmental drivers among sites, daily composite data of diffused attenuation (Kd490, used as a proxy for turbidity), chlorophyll a (Chl a), and sea surface temperature (SST) was obtained from MODIS (NOAA 2022). Differences in environmental conditions (e.g. SST, Chl a and Kd490) between the sites were analysed using monthly mean values.
DNA amplification and sequencing
The Symbiodiniaceae ITS2 region was amplified with the specific primer pair ITSintfor2 (5′- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGAATTGCAGAACTCCGTG-3′) and ITS2-reverse (5′TCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGGATCCA TATGCTTAAGTTCAGCGGGT-3′) (LaJeunesse 2002) that were used with adapters (underlined) for sequencing on the Illumina platform with a MiSeq V2 500 cycle kit. PCR amplification of ITS2 rDNA was conducted under the following conditions: 15 min at 95 °C, followed by 35 cycles of 94 °C for 45 s, 55 °C for 45 s, 72 °C for 1 min, and final extension of 72 °C for 10 min. PCR product was purified using Agencourt AMPure XP PCR purification beads, following the manufacture protocol. 16 µl of beads were added to each sample to remove 150 bp < according to the calculation of: sample volume X 0.8 = beads volume. Index PCR was then performed with unique combinations of Nextera XT index primers for each sample. Amplicons were cleaned, pooled, and sequenced at Genomics WA facility in Perth.
Bioinformatics
All filtering steps and statistical analyses were conducted in R software, 4.1.1 (R Core Team 2021). Raw sequence data were clustered into amplicon sequence variants (ASV’s) using the DADA2 pipeline (Callahan et al. 2016). We filtered poor quality samples with reads less than one thousand and any ASV’s with less than ten total reads across all samples for downstream analysis. Following quality control, ten samples and six ASV’s across all sites were removed. All sequences were aligned to a reference file consisting of known symbiont ITS2 haplotypes using BLASTn in order to taxonomically classify our unique ASV’s.
Data and statistical analysis
The spatial genetic structure of Turbinaria reniformis coral host samples was determined using SNP dataset derived from Evans et al., (2020). This dataset was processed with the dartR package (Gruber et al. 2018) and visualised through discriminant analysis of principle components (DAPC) using the adegenet package (Jombart 2008).
Difference in symbiont community composition between the study sites and between site by SST/ Chl a/ Kd490 interaction was analysed using two-way permutational multivariate analysis of variance (PERMANOVA) using the Bray–Curtis dissimilarity measure in the vegan package (Oksanen et al. 2012). Specifically, the pairwise.adonis2 function with 999 permutations was applied to explore pairwise variations across the study sites. To investigate, the effect of the environmental data (monthly mean) in driving the Symbiodiniaceae community composition, we performed a distance-based redundancy analysis (dbRDA) using the function capscale followed by an ANOVA to check the model significance. Kd490 and Chl a presented the same relative contribution (28%), thus, we chose to show Kd490 in the plot. Different statistical models (NMDS and PCoA) were employed before ultimately choosing the presented model. All tests yielded similar results, supporting the presented conclusions.
Shannon’s diversity index of the Symbiodiniaceae community was calculated for each site and differences along the latitudinal gradient were tested by a Kruskal-Willis test followed by a pairwise Wilcoxon test with Bonferroni correction method.
To investigate whether geographical distance between sites explained the variability in symbiont communities, we utilized a multiple matrix regression model with randomization (Wang 2013). This analysis employed the fossil package (Vavrek 2011) and included calculations of distance using earth.dist function within the ecodist package (Goslee and Urban 2007). To assess the relationship between coral host and its symbiont community, the mantel function was employed with Pearson’s correlation method and 999 permutations using the vegan package (Oksanen et al. 2012). Lastly, one-way ANOVA was performed followed by a TukeyHSD post-hoc tests to identify if there were significant differences in mean monthly environmental conditions (Kd490, Chl a and SST) between the six sites. All environmental data was Log10 transformed to meet statistical test assumptions.
Results
Environmental data
We identified strong environmental differences among our sites (Table S1). The monthly mean Kd490 data exhibit significant differences among all sites along the latitudinal gradient, except for MI-DA (ANOVA, F = 158.66, p < 0.0001). The northernmost site, BB, recorded the highest mean at 0.23 ± 0.04, while the southernmost site, Perth, recorded the lowest mean value at 0.07 ± 0.01. EG’s values closely resemble those of BB at 0.21 ± 0.04, while the remaining sites display Kd490 values ranging from 0.14 to 0.16 (Fig S1 and Table S2). Likewise, monthly mean Chl a levels exhibit significant variations among all sites, excluding MI-DA (ANOVA, F = 235.23, p < 0.0001). Highest Chl a values were observed at BB (3.26 ± 0.78 mg m3), while Perth had the lowest Chl a at 0.62 ± 0.23 (mg m3). A distinct temperature gradient was also observed across the sites (ANOVA, F = 83.4, p < 0.0001), with Perth, the coolest high-latitude site, displaying a monthly mean SST of 20.77 ± 1.71 °C, and BB, the warmest low-latitude site, recording a monthly mean SST of 27.05 ± 3.73 °C (Fig S1 and Table S1, S2).
ITS2 metabarcoding
Amplicon sequencing of the ITS region returned a total of 6,332,251 reads, with 115,131 mean reads per sample (n = 55; Table 1). These sequences were clustered into 19 different amplicon sequence variants (e.g. lineages), which were further classified into five different Symbiodiniaceae genera (13- Cladocopium, 1- Fugacium, 3- Symbiodinium, 1- Durusdinium, 1- Breviolum; Fig. 2).
Symbiont community composition
Although the Symbiodiniaceae genus Cladocopium dominated all colonies across all examined sites (Fig. 2), we found strong differences in Cladocopium lineages among our tropical and higher-latitude sites. At the four Pilbara sites coral colonies had 7–12 ASV’s per sample which were primarily associated with the C33.1a lineage (42.3% at BB, 31% at DA, 25.3% at MI and 20.7% at EG;Table 1; Fig. 2). In SB, the C33.1e lineage dominated, comprising 86.8% of the Symbiodiniaceae type, while Perth displayed a more variable symbiont community with the c.b (26.8%), and C33.1c (12.1%) lineages being the most abundant among samples.
Although all samples were dominated by Cladocopium, other genera within the Symbiodiniaceae family, such as Durusdinium, Symbiodinium, Breviolum and Fugacium, were detected at background levels. In Perth, one sample was associated with clade F (1.46%), and one with clade B18 (64.7%). Three samples from DA were associated with clade D1 (0.002–12%), while the three different sub clade A were found in three different samples from EG (A.a; 0.46%), EG (A.b; 0.01%) and SB (A.c; 0.004%) (Fig. 2).
PERMANOVA analysis revealed significant effect of site (r2 = 0.28, F = 3.89, p = 0.001) on the symbiont community assemblages (Fig. 3, Table S4). SB and Perth were found to have significantly distinct symbiodiniceae communities compared to all other sites, and to each other (r2 = 0.31, F = 5.59, p = 0.004). Additionally,e nvironmental factors showed significant correlation with the variations in the symbiont community composition, as indicated by the dbRDA model: SST (r2 = 0.19, F = 3.29, p = 0.001), Kd490 (r2 = 0.22, F = 3.82, p = 0.001) and Chl a (r2 = 0.22, F = 3.83, p = 0.001). SST explained 43% of the community variation followed by Kd490 (28.6%) and Chl a (28.2%) (Table S3).
Symbiont community diversity
The Shannon diversity index (Fig S2), calculated for Syimbiodiniceae community profiles in each sample, was significantly different between the sites (Kruskal–Wallis, Chi sq = 33.02, df = 5, p < 0.0001), and in general showed a pattern of reduced diversity in higher-latitude sites (SB and PE). Shark Bay exhibited the lowest community diversity, with 6 ± 2.23 ASV’s per sample (Fig. 4; Table 1). Perth also displayed lower levels of diversity than its tropical counterparts, but with more variable symbiont community profiles than the Shark Bay region (Fig. 4; Table 1).
Geographical distance was not found to have a significant effect on the symbiont community composition between the sampled sites (r2 = 0.02, p = 0.679). Furthermore, the host genetic structure and symbiont community composition revealed no significant correlation (R2 = 0.03, p = 0.194).
Discussion
In this study, we investigated the composition of Symbiodiniaceae communities in Turbinaria reniformis along the Western Australian coast, spanning approximately 1,200 km from tropical low-latitude reefs to temperate high-latitude reefs. Our findings reveal that all T. reniformis colonies along the Western Australian coast associate predominantly with Cladocopium. However, within this genus, we found spatial variation of the lineages communities’ composition, influenced primarily by SST, and to a lesser extent by Kd490 and Chl a. Surprisingly, host genetic data did not align with symbiont community divergence, suggesting a complex interplay of environmental factors in shaping these associations.
Latitudinal and environmental differentiation in symbiont communities have been well-documented in studies conducted on various coral species in distinct regions, such as the Red Sea (Terraneo et al. 2019), South China Sea (Chen et al. 2019), and Singapore (Guest et al. 2016). These studies reveal a pattern of transitioning from Cladocopium-dominated symbiont communities in cooler, clearer waters to the stress tolerant Durusdinium in warmer and more turbid environments. However, a study by Matias et al., (2023) examining Acropora tenuis across a latitude gradient in the Great Barrier Reef (GBR) found a consistent high dominance of Cladocopium across the gradient. Here, ASV’s associated with Durusdinium, Symbiodinium, Breviolum, or Fugacium were rare and only identified in nine colonies scattered across all sites. This data suggests that these Symbiodiniaceae genera occur at background levels in the coral Turbinaria reniformis. The role of these background symbionts remains unclear, and under our experimental design, their presence cannot be attributed to any specific environmental driver. Therefore, it is plausible that they represent transient rather than stable symbiont partners (Lee et al. 2016).
It is crucial to acknowledge that different taxa may exhibit varying affinities for specific symbiont genus, emphasizing the need for caution when comparing studies involving different host taxa (Smith et al. 2020). In a prior study in WA by Silverstein et al., (2011), which explored symbiont associations in various coral genera, Turbinaria mesenterina from Ningaloo and T. mesenterina and T. reniformis from Dunsborough, south of Perth, were also found to be predominantly associated with Cladocopium. Similarly, Thomas et al., (2014) observed that Cladocopium was the dominant symbiont in Acropora sp. from two distinct reefs in WA. These findings collectively underscore high stability and specificity to Cladocopium across large geographic distances in WA, despite significant variations in SST and Kd490.
The composition of Cladocopium communities exhibited significant variations between sites and in relation to environmental factors along the latitudinal gradient. Specifically, the four Pilbara sites displayed strong similarities in symbiont community assemblages, with a dominant presence of the C33.1a lineage, indicating a shared bioregion. In contrast, Shark Bay colonies exhibited limited community diversity, lacking the presence of C33.1a, while those in Perth displayed more variable symbiont assemblages, including the highest number of ASV’s among the sites.
While, previous literature lacks data on C33.1, higher SST’s in the Pilbara region might explain the predominant presence of C33.1a in the four northern sites, while the influences of Kd490 and Chl a on symbiont community diversity were comparable but less pronounced. The limited variability in the symbiont community of Shark Bay may be attributed to its unique environmental conditions, as it serves as a transition zone, where the Leeuwin Current meets the Ningaloo Counter-Current, creating a connectivity boundary for particle transport, potentially restricting symbiont distribution (Evans et al. 2019; Woo et al. 2006). Further investigations are warranted in this area, particularly focusing on coral host populations and their associated symbiont communities. Similar patterns were observed in the Persian/Arabian Gulf, where extreme environmental factors, such as high SST and salinity, constrained Symbiodiniaceae diversity, leading to the prevalence of Cladocopium symbionts with high heat and salinity tolerance (D’Angelo et al. 2015; Hume et al. 2016; Ziegler et al. 2017). Additionally, high turbidity was suggested to be responsible for the low richness and diversity of Symbiodiniaceae in Hong Kong coral reefs (Ng and Ang 2016).
Differences between various Cladacopium lineages and their effect on the coral host are still poorly understood. Moreover, coral species with high symbiont specificity may have limited capacity to switch or shuffle symbionts in response to environmental changes (Johnston et al. 2022). Interestingly, although differences were identified in the lineage communities between the regions, this was not attributed to geographical distance or related to the host genetic differentiation. This pattern may be attributed to the reproductive strategy of Turbinaria reniformis, a broadcast spawning coral that obtains its symbionts horizontally (i.e., acquired from the environment) (Baird et al. 2009). Another possibility is that Cladocopium subclade community divergence among reefs might be attributed not only to dispersal limitation but also to environmental specialization and local adaptation of the symbionts (Davies et al. 2020). Despite a lack of relationship between symbiont and host structure, similar overall trends in both the host and symbiont datasets were evident and showed that Perth and SB were highly diverged from their tropical counterparts to the north. The strong structure in the host within the Pilbara, and the lack of differences in symbiont communities among these sites, was likely the driver of the non-significant relationship between the host genetic structure and the symbiont communities. Nevertheless, the pronounced genetic divergence of the host at higher-latitude sites aligns consistently with the patterns of symbiont community composition identified in this study. This observation suggests that T.reniformis coral host have some flexibility in their symbiotic associations with Cladocopium across their range and within their specific environments (Berkelmans & Van Oppen 2006; Davies et al. 2020).
The genus Cladocopium is highly diversified, a fact that has been associated with functional variation in symbiont thermal tolerance across reefs as well as with functional differences between reef zones, providing support for the potential for reef-specific symbiont communities (Barfield et al. 2018; Davies et al. 2020; Howells et al. 2011). We hypothesise that Turbinaria sp. widespread nature is thus attributed to its strong association with Cladocopium. This insight is crucial for planning conservation strategies in extreme or marginal reefs. We also highlight that coral reefs of WA offer an excellent study system for investigating fine-scale local adaptation potential of Cladocopium and its coral hosts.
Further in-depth investigations are needed for other generalist and resilient species, to substantiate such assumptions. This becomes even more pertinent considering turbid reefs may serve as refugia under climate change (Cacciapaglia & van Woesik 2016; Morgan et al. 2017). As we progress in researching marginal reefs and their potential role as refugia, integrative molecular approaches that consider both Symbiodiniaceae and host population structure will be imperative. These approaches will provide a more holistic understanding of how different life history strategies, including reproductive and symbiont acquisition modes, influence the connectivity levels between neighbouring coral habitats.
References
Abdul Wahab MA, Fromont J, Gomez O, Fisher R, Jones R (2017) Comparisons of benthic filter feeder communities before and after a large-scale capital dredging program. Mar Pollut Bull 122(1–2):176–193. https://doi.org/10.1016/j.marpolbul.2017.06.041
Baird AH, Guest JR, Willis BL (2009) Systematic and biogeographical patterns in the reproductive biology of scleractinian corals. Annu Rev Ecol Evol System 40(1):551–571. https://doi.org/10.1146/annurev.ecolsys.110308.120220
Baker AC (2001) Reef corals bleach to survive change. Nature 411(6839):765–766. https://doi.org/10.1038/35081151
Baker AC (2003) Flexibility and specificity in coral-algal symbiosis: diversity, ecology, and biogeography of Symbiodinium. Annu Rev Ecol Evol Syst 34(1):661–689. https://doi.org/10.1146/annurev.ecolsys.34.011802.132417
Baker DM, Andras JP, Jordán-Garza AG, Fogel ML (2013) Nitrate competition in a coral symbiosis varies with temperature among Symbiodinium clades. ISME J 7(6):1248–1251. https://doi.org/10.1038/ismej.2013.12
Barfield SJ, Aglyamova GV, Bay LK, Matz MV (2018) Contrasting effects of Symbiodinium identity on coral host transcriptional profiles across latitudes. Mol Ecol 27(15):3103–3115. https://doi.org/10.1111/MEC.14774
Berkelmans R, Van Oppen MJH (2006) The role of zooxanthellae in the thermal tolerance of corals: a “nugget of hope” for coral reefs in an era of climate change. Proc R Soc B Biolo Sci 273(1599):2305–2312. https://doi.org/10.1098/rspb.2006.3567
Cacciapaglia C, van Woesik R (2016) Climate-change refugia: Shading reef corals by turbidity. Glob Change Biol 22(3):1145–1154. https://doi.org/10.1111/gcb.13166
Callahan BJ, McMurdie PJ, Rosen MJ, Han AW, Johnson AJA, Holmes SP (2016) DADA2: high-resolution sample inference from Illumina amplicon data. Nat Methods 13(7):581–583. https://doi.org/10.1038/nmeth.3869
Camp EF, Schoepf V, Mumby PJ, Hardtke LA, Rodolfo-Metalpa R, Smith DJ, Suggett DJ (2018) The future of coral reefs subject to rapid climate change: lessons from natural extreme environments. Front Mar Sci 5:4. https://doi.org/10.3389/fmars.2018.00004
Chen B, Yu K, Liang J, Huang W, Wang G, Su H, Qin Z, Huang X, Pan Z, Luo W, Luo Y, Wang Y (2019) Latitudinal variation in the molecular diversity and community composition of symbiodiniaceae in coral from the South China Sea. Front Microbiol 10:1278. https://doi.org/10.3389/fmicb.2019.01278
Cresswell GR, Golding TJ (1980) Observations of a south-flowing current in the southeastern Indian Ocean. Deep-Sea Res 27:449–466
D’Angelo C, Hume BCC, Burt J, Smith EG, Achterberg EP, Wiedenmann J (2015) Local adaptation constrains the distribution potential of heat-tolerant Symbiodinium from the Persian/Arabian Gulf. ISME J 9(12):2551–2560. https://doi.org/10.1038/ismej.2015.80
Davies S, Moreland K, Wham D, Kanke M, Matz MV (2020) Cladocopium community divergence in two Acropora coral hosts across multiple spatial scales. Mol Ecol 29(23):1–14. https://doi.org/10.1111/mec.15668
Evans RD, Ryan NM, Travers MJ, Feng M, Hitchen Y, Kennington WJ (2019) A seascape genetic analysis of a stress-tolerant coral species along the Western Australian coast. Coral Reefs 38(1):63–78. https://doi.org/10.1007/s00338-018-01751-y
Evans RD, Wilson SK, Fisher R, Ryan NM, Babcock R, Blakeway D, Bond T, Dorji P, Dufois F, Fearns P, Lowe RJ, Stoddart J, Thomson DP (2020) Early recovery dynamics of turbid coral reefs after recurring bleaching events. J Environ Manag 268:110666. https://doi.org/10.1016/j.jenvman.2020.110666
Evans RD, Thomas L, Kennington WJ, Ryan NM, Wilson NG, Richards Z, Lowe RJ, Tuckett C (2021) Population genetic structure of a broadcast-spawning coral across a tropical–temperate transition zone reveals regional differentiation and high-latitude reef isolation. J Biogeogr 48(12):1–11. https://doi.org/10.1111/jbi.14280
Falkowski PG, Dubinsky Z, Muscatine L, Porter JW (1984) Light and the bioenergetics of a symbiotic coral. Bioscience 34(11):705–709. https://doi.org/10.2307/1309663
Fromont J, Wahab MAA, Gomez O, Ekins M, Grol M, Hooper JNA (2016) Patterns of sponge biodiversity in the Pilbara Northwestern Australia. Diversity 8(4):21. https://doi.org/10.3390/d8040021
Garren M, Walsh SM, Caccone A, Knowlton N (2006) Patterns of association between Symbiodinium and members of the Montastraea annularis species complex on spatial scales ranging from within colonies to between geographic regions. Coral Reefs 25(4):503–512. https://doi.org/10.1007/S00338-006-0146-1/TABLES/2
Glynn PW (1984) Widespread coral mortality and the 1982–83 El Niño warming event. Environ Conserv 11(2):133–146. https://doi.org/10.1017/S0376892900013825
Goslee SC, Urban DL (2007) The ecodist package for dissimilarity-based analysis of ecological data. J Stat Softw 22:1–19
Gruber B, Unmack PJ, Berry OF, Georges A (2018) dartr: An r package to facilitate analysis of SNP data generated from reduced representation genome sequencing. Mol Ecol Resour 18(3):691–699. https://doi.org/10.1111/1755-0998.12745
Guest JR, Low J, Tun K, Wilson B, Ng C, Raingeard D, Ulstrup KE, Tanzil JTI, Todd PA, Toh TC, McDougald D, Chou LM, Steinberg PD (2016) Coral community response to bleaching on a highly disturbed reef. Sci Rep 6(1):20717. https://doi.org/10.1038/srep20717
Harmelin-Vivien ML (1994) The effects of storms and cyclones on coral reefs: a review. J Coastal Res 12:211–231. https://doi.org/10.2307/25735600
Hennige SJ, Smith DJ, Walsh SJ, McGinley MP, Warner ME, Suggett DJ (2010) Acclimation and adaptation of scleractinian coral communities along environmental gradients within an Indonesian reef system. J Exp Mar Biol Ecol 391(1–2):143–152. https://doi.org/10.1016/j.jembe.2010.06.019
Heron SF, Maynard JA, Van Hooidonk R, Eakin CM (2016) Warming trends and bleaching stress of the world’s coral reefs 1985–2012. Sci Rep 6(1):1–14. https://doi.org/10.1038/srep38402
Hoegh-Guldberg O (1999) Climate change, coral bleaching and the future of the world’s coral reefs. Mar Freshw Res 50:839–866. https://doi.org/10.1071/MF00030
Hoegh-Guldberg O, Mumby PJ, Hooten AJ, Steneck RS, Greenfield P, Gomez E, Harvell CD, Sale PF, Edwards AJ, Caldeira K, Knowlton N, Eakin CM, Iglesias-Prieto R, Muthiga N, Bradbury RH, Dubi A, Hatziolos ME (2007) Coral reefs under rapid climate change and ocean acidification. Science 318(5857):1737–1742. https://doi.org/10.1126/science.1152509
Howells EJ, Beltran VH, Larsen NW, Bay LK, Willis BL, Van Oppen MJH (2011) Coral thermal tolerance shaped by local adaptation of photosymbionts. Nature Clim Change 2(2):116–120. https://doi.org/10.1038/nclimate1330
Hughes TP, Baird AH, Bellwood DR, Card M, Connolly SR, Folke C, Grosberg R, Hoegh-Guldberg O, Jackson JBC, Kleypas J, Lough JM, Marshall P, Nystro¨m M, Palumbi SR, Pandolfi JM, Rosen B, Roughgarden J (2003) Climate change, human impacts, and the resilience of coral reefs. Science 301:929–933. https://doi.org/10.1126/science.1085046
Hughes TP, Kerry JT, Álvarez-Noriega M, Álvarez-Romero JG, Anderson KD, Baird A, Babcock RC, Beger M, Bellwood DR, Berkelmans R, Bridge TC, Butler IR, Byrne M, Cantin NE, Comeau S, Connolly SR, Cumming GS, Dalton SJ, Diaz-Pulido G, Mark Eakin C, Figueira WF, Gilmour JP, Harrison HB, Heron SF, Hoey AS, Jean-Paul A, Hoogeboom MO, Kennedy EV, Lough JM, Lowe RJ, Liu G, McCulloch MT, Malcolm HA, McWilliam MJ, Pandolfi JM, Pears RJ, Pratchett MS, Schoepf V, Simpson T, Skirving WJ, Sommer B, Torda G, Wachenfeld DR, Willis BL, Wilson SK (2017) Global warming and recurrent mass bleaching of corals. Nature 543(7645):373–377. https://doi.org/10.1038/nature21707
Hume BCC, Voolstra CR, Arif C, D’Angelo C, Burt JA, Eyal G, Loya Y, Wiedenmann J (2016) Ancestral genetic diversity associated with the rapid spread of stress-tolerant coral symbionts in response to holocene climate change. Proc Natl Acad Sci USA 113(16):4416–4421. https://doi.org/10.1073/pnas.1601910113
Johnston EC, Cunning R, Burgess SC (2022) Cophylogeny and specificity between cryptic coral species (Pocillopora spp.) at Mo′orea and their symbionts (Symbiodiniaceae). Mol Ecol 31(20):5368–5385. https://doi.org/10.1111/mec.16654
Jombart T (2008) Adegenet: a R package for the multivariate analysis of genetic markers. Bioinformatics 24(11):1403–1405. https://doi.org/10.1093/bioinformatics/btn129
Kleypas JA, Mcmanusi JW, Menez LAB (1999) Environmental limits to coral reef development: where do we draw the line? Am Zool 39(1):146–159. https://doi.org/10.1093/icb/39.1.146
LaJeunesse TC (2002) Diversity and community structure of symbiotic dinoflagellates from Caribbean coral reefs. Mar Biol 141(2):387–400. https://doi.org/10.1007/S00227-002-0829-2
LaJeunesse TC, Bhagooli R, Hidaka M, deVantier L, Done T, Schmidt GW, Fitt WK, Hoegh-Guldberg O (2004) Closely related Symbiodinium spp. differ in relativedominance in coral reef host communities acrossenvironmental, latitudinal and biogeographicgradients. Mar Ecol Prog Ser 284:147–161
LaJeunesse TC, Pettay DT, Sampayo EM, Phongsuwan N, Brown B, Obura DO, Hoegh-Guldberg O, Fitt WK (2010) Long-standing environmental conditions, geographic isolation and host–symbiont specificity influence the relative ecological dominance and genetic diversification of coral endosymbionts in the genus Symbiodinium. J Biogeogr 37(5):785–800. https://doi.org/10.1111/j.1365-2699.2010.02273.x
LaJeunesse TC, Parkinson JE, Gabrielson PW, Jeong HJ, Reimer JD, Voolstra CR, Santos SR (2018) Systematic revision of symbiodiniaceae highlights the antiquity and diversity of coral endosymbionts. Curr Biol 28(16):2570-2580.e6. https://doi.org/10.1016/j.cub.2018.07.008
Lajeunesse TC, Wham DC, Pettay DT, Parkinson JE, Keshavmurthy S, Chen CA (2014) Ecologically differentiated stress-tolerant endosymbionts in the dinoflagellate genus Symbiodinium (Dinophyceae) Clade D are different species. Phycologia 53(4):305–319. https://doi.org/10.2216/13-186.1
Lee MJ, Jeong HJ, Jang SH, Lee SY, Kang NS, Lee KH, Kim HS, Wham DC, LaJeunesse TC (2016) Most Low-Abundance “Background” Symbiodinium spp. Are Transitory and Have Minimal Functional Significance for Symbiotic Corals. Microb Ecol 71(3):771–783. https://doi.org/10.1007/S00248-015-0724-2/FIGURES/6
Lough JM (1998) Coastal climate of northwest Australia and comparisons with the Great Barrier Reef. Coral Reefs 17(4):351–367. https://doi.org/10.1007/s003380050139
Marsh LM (1990) Hermatypic corals of Shark Bay, Western Australia. Research in Shark Bay. Report of the France-Australe Bicentenary Expedition Committee. Western Australian Museum, Perth. 107-14
Matias AMA, Popovic I, Thia JA, Cooke IR, Torda G, Lukoschek V, Bay LK, Kim SW, Riginos C (2023) Cryptic diversity and spatial genetic variation in the coral Acropora tenuis and its endosymbionts across the Great Barrier Reef. Evol Appl 16(2):293–310. https://doi.org/10.1111/eva.13435
McLean DL, Langlois TJ, Newman SJ, Holmes TH, Birt MJ, Bornt KR, Bond T, Collins DL, Evans SN, Travers MJ, Wakefield CB, Babcock RC, Fisher R (2016) Distribution, abundance, diversity and habitat associations of fishes across a bioregion experiencing rapid coastal development. Estuar Coast Shelf Sci 178:36–47. https://doi.org/10.1016/j.ecss.2016.05.026
Morgan KM, Perry CT, Johnson JA, Smithers SG (2017) Nearshore turbid-zone corals exhibit high bleaching tolerance on the Great Barrier Reef following the 2016 ocean warming event. Front Mar Sci 4:1–13. https://doi.org/10.3389/fmars.2017.00224
Moustaka M, Langlois TJ, Mclean D, Bond T, Fisher R, Fearns P, Dorji P, Evans RD (2018) The effects of suspended sediment on coral reef fish assemblages and feeding guilds of north-west Australia. Coral Reefs 37:659–673. https://doi.org/10.1007/s00338-018-1690-1
Muscatine L, Porter JW (1977) Reef corals: mutualistic symbioses adapted to nutrient-poor environments. Bioscience 27(7):454–460. https://doi.org/10.2307/1297526
Muscatine L, McCloskey LR, Marian RE (1981) Estimating the daily contribution of carbon from zooxanthellae to coral animal respiration1. Limnol Oceanogr 26(4):601–611. https://doi.org/10.4319/LO.1981.26.4.0601
Ng TY, Ang P (2016) Low symbiont diversity as a potential adaptive strategy in a marginal non-reefal environment: a case study of corals in Hong Kong. Coral Reefs 35(3):941–957. https://doi.org/10.1007/s00338-016-1458-4
NOAA (2022) ERDDAP—List of griddap Datasets. https://coastwatch.pfeg.noaa.gov/erddap/griddap/index.html?page=1&itemsPerPage=1000
O’Leary MJ, Hearty PJ, McCulloch MT (2008) U-series evidence for widespread reef development in Shark Bay during the last interglacial. Palaeogeogr Palaeoclimatol Palaeoecol 259(4):424–435. https://doi.org/10.1016/j.palaeo.2007.10.022
Oksanen, J., Blanchet, F. G., Kindt, R., Legendre, P., Minchin, P. R., O’Hara, R. B., Simpson, G. L., Sólymos, P., Stevens, M. H. H., & Wagner, H. (2012). Vegan: Community Ecology Package. http://CRAN.R-project.org/package=vegan
Oliver TA, Palumbi SR (2011) Many corals host thermally resistant symbionts in high-temperature habitat. Coral Reefs 30(1):241–250. https://doi.org/10.1007/s00338-010-0696-0
Page CE, Leggat W, Heron SF, Choukroun SM, Lloyd J, Ainsworth TD (2019) Seeking resistance in Coral Reef ecosystems: the interplay of biophysical factors and bleaching resistance under a changing climate: the interplay of a reef’s biophysical factors can mitigate the coral bleaching response. BioEssays 41(7):1–12. https://doi.org/10.1002/bies.201800226
Pobar, G., Orr, K., Cavana, M., & Osmond, M. (1992) Marmion Marine Park Management Plan 1992–2002. https://www.dbca.wa.gov.au/management/parks/plan-our-parks/marmion-marine-park
R Core Team (2021) R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing, Vienna, Austria
Rowan R, Knowlton N, Baker A, Jara J (1997) Landscape ecology of algal symbionts creates variation in episodes of coral bleaching. Nature 388(6639):265–269. https://doi.org/10.1038/40843
Silverstein RN, Correa AMS, LaJeunesse TC, Baker AC (2011) Novel algal symbiont (Symbiodinium spp.) diversity in reef corals of Western Australia. Mar Ecol Prog Ser 422:63–75. https://doi.org/10.3354/meps08934
Smith EG, Hume BCC, Delaney P, Wiedenmann J, Burt JA (2017) Genetic structure of coral-Symbiodinium symbioses on the world’s warmest reefs. PLoS ONE 12(6):e0180169. https://doi.org/10.1371/JOURNAL.PONE.0180169
Smith EG, Gurskaya A, Hume BCC, Voolstra CR, Todd PA, Bauman AG, Burt JA (2020) Low Symbiodiniaceae diversity in a turbid marginal reef environment. Coral Reefs 39(3):545–553. https://doi.org/10.1007/s00338-020-01956-0
Terraneo TI, Fusi M, Hume BCC, Arrigoni R, Voolstra CR, Benzoni F, Forsman ZH, Michael L, Berumen L (2019) Environmental latitudinal gradients and host-specificity shape Symbiodiniaceae distribution in Red Sea Porites corals. J Biogeogr 46:2323–2335. https://doi.org/10.1111/jbi.13672
Thomas L, Kendrick GA, Kennington WJ, Richards ZT, Stat M (2014) Exploring Symbiodinium diversity and host specificity in Acropora corals from geographical extremes of Western Australia with 454 amplicon pyrosequencing. Mol Ecol 23(12):3113–3126. https://doi.org/10.1111/mec.12801
Thomas L, Kennington WJ, Evans RD, Kendrick GA, Stat M (2017) Restricted gene flow and local adaptation highlight the vulnerability of high-latitude reefs to rapid environmental change. Glob Change Biol 23(6):2197–2205. https://doi.org/10.1111/GCB.13639
Thomas L, López EH, Morikawa MK, Palumbi SR (2019) Transcriptomic resilience, symbiont shuffling, and vulnerability to recurrent bleaching in reef-building corals. Mol Ecol 28(14):3371–3382. https://doi.org/10.1111/MEC.15143
Tonk L, Sampayo EM, Weeks S, Magno-Canto M, Hoegh-Guldberg O (2013) Host-specific interactions with environmental factors shape the distribution of Symbiodinium across the Great Barrier Reef. PLoS ONE 8(7):e68533. https://doi.org/10.1371/JOURNAL.PONE.0068533
Vavrek, M. J. (2011) Fossil: Palaeoecological and palaeogeographical analysis tools (Vol. 14). http://palaeo-electronica.orghttp://palaeo-electronica.org/2011_1/238/index.html
Veron JEN (1993) Corals of Australia and the Indo-Pacific. Choice Reviews Online 31(4). https://doi.org/10.5860/CHOICE.31-2102
Wang IJ (2013) Examining the full effect of landscape heterogeneity on spatial genetic variation: a multiple matrix regression approach for quantifying geographical and ecological isolation. Evolution 67(12):3403–3411. https://doi.org/10.1111/EVO.12134
Wicks LC, Sampayo E, Gardner JPA, Davy SK (2010) Local endemicity and high diversity characterise high-latitude coral– Symbiodinium partnerships. Coral Reefs 29(4):989–1003. https://doi.org/10.1007/s00338-010-0649-7
Woo M, Pattiaratchi C, Schroeder W (2006) Dynamics of the Ningaloo current off Point Cloates Western Australia. Mar Freshwater Res 57(3):291–301. https://doi.org/10.1071/MF05106
Wyatt ASJ, Hewitt CL, Walker DI, Ward TJ (2005) Marine introductions in the Shark Bay World Heritage property, Western Australia: a preliminary assessment. Divers Distrib 11(1):33–44. https://doi.org/10.1111/j.1366-9516.2005.00109.x
Ziegler M, Roder C, Büchel C, Voolstra CR (2015) Niche acclimatization in Red Sea corals is dependent on flexibility of host-symbiont association. Mar Ecol Prog Ser 533:149–161. https://doi.org/10.3354/meps11365
Ziegler M, Arif C, Burt JA, Dobretsov S, Roder C, LaJeunesse TC, Voolstra CR (2017) Biogeography and molecular diversity of coral symbionts in the genus Symbiodinium around the Arabian Peninsula. J Biogeogr 44(3):674–686. https://doi.org/10.1111/jbi.12913
Funding
Open Access funding enabled and organized by CAUL and its Member Institutions. Sample collections were funded by the Chevron-Operated Wheatstone Project’s State Environmental Offsets Project and the Woodside-Operated Pluto Project for the State Environmental Offsets Program administered by DBCA. Laboratory work and sequencing was funded by the School of Earth Sciences, University of Western Australia (PG19101332, A.Z) and by the Holsworth Wildlife Research Endowment, the Ecological Society of Australia (PG51006700, A.Z.).
Author information
Authors and Affiliations
Contributions
Conceptualization was done by Adi Zweifler, Luke Thomas; Methodology was done by Adi Zweifler, Luke Thomas, and Richard D. Evans, Data analysis was done by Adi Zweifler; Writing original draft was done by Adi Zweifler; Manuscript revisions was done by Adi Zweifler, Richard D. Evans, Nicola Browne, and Luke Thomas; Funding acquisition was done by Adi Zweifler; Resources was done by Adi Zweifler, Luke Thomas, and Richard D. Evans; Supervision was done by Luke Thomas, Nicola Browne.
Corresponding author
Ethics declarations
Conflict of interest
The authors have no competing interests to declare that are relevant to the content of this article.
Additional information
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Information
Below is the link to the electronic supplementary material.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Zweifler, A., Evans, R.D., Browne, N.K. et al. Symbiont community dynamics in the turbid reef specialist, Turbinaria reniformis, along a latitudinal and environmental gradient in Western Australia. Coral Reefs 43, 1161–1171 (2024). https://doi.org/10.1007/s00338-024-02528-2
Received:
Accepted:
Published:
Issue Date:
DOI: https://doi.org/10.1007/s00338-024-02528-2