Abstract
Genetic susceptibility to familial colorectal cancer (CRC), including for individuals classified as Familial Colorectal Cancer Type X (FCCTX), remains poorly understood. We describe a multi-generation CRC-affected family segregating pathogenic variants in both BRCA1, a gene associated with breast and ovarian cancer and RNF43, a gene associated with Serrated Polyposis Syndrome (SPS). A single family out of 105 families meeting the criteria for FCCTX (Amsterdam I family history criteria with mismatch repair (MMR)-proficient CRCs) recruited to the Australasian Colorectal Cancer Family Registry (ACCFR; 1998–2008) that underwent whole exome sequencing (WES), was selected for further testing. CRC and polyp tissue from four carriers were molecularly characterized including a single CRC that underwent WES to determine tumor mutational signatures and loss of heterozygosity (LOH) events. Ten carriers of a germline pathogenic variant BRCA1:c.2681_2682delAA p.Lys894ThrfsTer8 and eight carriers of a germline pathogenic variant RNF43:c.988 C > T p.Arg330Ter were identified in this family. Seven members carried both variants, four of which developed CRC. A single carrier of the RNF43 variant met the 2019 World Health Organization (WHO2019) criteria for SPS, developing a BRAF p.V600 wildtype CRC. Loss of the wildtype allele for both BRCA1 and RNF43 variants was observed in three CRC tumors while a LOH event across chromosome 17q encompassing both genes was observed in a CRC. Tumor mutational signature analysis identified the homologous recombination deficiency (HRD)-associated COSMIC signatures SBS3 and ID6 in a CRC for a carrier of both variants. Our findings show digenic inheritance of pathogenic variants in BRCA1 and RNF43 segregating with CRC in a FCCTX family. LOH and evidence of BRCA1-associated HRD supports the importance of both these tumor suppressor genes in CRC tumorigenesis.
Similar content being viewed by others
Avoid common mistakes on your manuscript.
Introduction
Colorectal cancer (CRC) has one of the highest rates of aggregation within families (familial CRC), with up to 35% of CRC thought to be caused by inherited genetic risk factors [1]. However, the underlying cause of CRC can be assigned to one of the inherited CRC and polyposis syndromes in only 5–10% of cases [2], therefore, the genetic cause of the majority of familial CRC remains unknown. The term Familial Colorectal Cancer Type X (FCCTX) was proposed to define families with a strong CRC family history that meet the Amsterdam I criteria [3] where the tumors are DNA mismatch repair (MMR)-proficient/microsatellite stable and do not carry a germline pathogenic variant in one of the MMR genes (Lynch syndrome) [4, 5]. The genetic factors underlying FCCTX are poorly understood and are likely to be heterogeneous involving multiple susceptibility genes [6].
Serrated polyposis syndrome (SPS) is characterized by the presence of multiple serrated colorectal polyps (hyperplastic polyp, sessile serrated lesion (SSL) and traditional serrated adenoma) resulting in an increased risk of developing CRC [7,8,9]. The diagnostic criteria for SPS was re-defined by the World Health Organization (WHO) in 2019 [10] to include (i) 5 or more serrated polyps proximal to the rectum, all 5 mm or greater in size, with 2 or more 10 mm or greater in size or (ii) more than 20 serrated polyps of any size in the large bowel, with 5 or more proximal to the rectum. The progression from serrated polyp to carcinoma, referred to as the serrated neoplasia pathway of tumorigenesis, is characterized by distinct molecular features, including the presence of microsatellite instability (MSI), high levels of the CpG island methylator phenotype (CIMP) and somatic mutations in the oncogenes BRAF or KRAS [11]. However, the genetic etiology of SPS remains poorly understood [12, 13]. Recently, germline pathogenic variants in RNF43 have been proposed to underlie SPS [14,15,16,17,18], but they account for only a small proportion of cases [19]. As such, expert groups are yet to recommend the inclusion of RNF43 in multi-gene testing panels for patients with SPS [12].
The BRCA1 gene acts as a tumor suppressor through its role in DNA repair [20]. Germline pathogenic variants in BRCA1 confer high risks of breast and ovarian cancers [21]. The association between BRCA1 pathogenic variants and CRC development is more uncertain [22]. Multiple studies have investigated whether carriers of germline BRCA1 pathogenic variants have an increased risk of developing CRC, with mixed results [23, 24].
It has been suggested that digenic inheritance may account for some cases of familial CRC and polyposis syndromes, however there are few reports in the literature [25,26,27]. In this study, we describe a family meeting FCCTX criteria where multiple cancer-affected individuals carried germline pathogenic variants in both the BRCA1 and RNF43 genes on chromosome 17q. The tumor characteristics from carriers were assessed to characterize the drivers of tumorigenesis. Our findings demonstrate a possible role for digenic inheritance in the predisposition to familial CRC.
Methods
Study cohort
The family presented was identified from the Australasian Colorectal Cancer Family Registry (ACCFR) (HREC:13,094) [28,29,30]. The ACCFR recruited multiple-member CRC-affected families from Family Cancer Clinics across Australia and New Zealand between 1998 and 2008. Participants provided written consent to access their tumor tissue and provided a blood sample [30]. Methodology for germline MMR and MUTYH gene testing and tumor characterization have been described previously [28].
Germline sequencing and variant detection
CRC-affected individuals 009 and 014 had germline whole exome sequencing (WES) performed. Briefly, 50ng of genomic DNA was fragmented to an average size of 180 bp in length using a Covaris focused-ultrasonicator (Covaris, Woburn, MA, USA). An Illumina sequencing technology compatible whole genome library was created using Kapa Biosystems Hyper Prep Kits (Kapa Biosystems Inc., Wilmington, MA, USA). These libraries were then subjected to whole exome target enrichment using Agilent SureSelect hybrid capture version 4 kits (Agilent Technologies, Santa Clara, CA, USA). Parallel sequencing of libraries was performed on Illumina HiSeq2000/2500 system using version 1.5 or version 3 chemistry using paired-end 2 × 100 bp reads (Illumina, San Diego, CA, USA). All sequencing reads were converted to industry standard FASTQ files using BCL2FASTQ v1.8.4. FASTQ files were processed using a pipeline based on industry standard software packages and programs. Sequencing reads were aligned to the GRCh37 human genome reference using v0.7.8 BWA-MEM aligner [31] to generate BAM files. SAMtools v0.1.19 [32] was used to sort BAM files and Picard v1.111 (http://broadinstitute.github.io/picard/) to mark duplicate read pairs. Post alignment joint insertion/deletion (indel) realignment and base quality scores recalibration was performed on the BAM files using GATK v3.1-1 [33]. Variants were called from germline BAM files individually using GATK Haplotype Caller v3.1-1 [34] and SAMtools v0.1.19 [35].
Germline variant annotation
Germline variants were annotated with the Ensembl Variant Effect Predictor release 105 (December 2021) for the human genome reference GRCh37 including the CADD predicted pathogenicity scores for each variant [36, 37]. The RefSeq transcript NM_007300.4 was used for BRCA1. The RefSeq transcript NM_017763.5 was used for RNF43. Sanger sequencing of the BRCA1 and RNF43 pathogenic variants was used for confirmation of the variants in persons 009 and 014 and to segregate the variants in 19 other family members with available DNA.
Tumor tissue sample processing and nucleic acid preparation
Where available, formalin-fixed paraffin-embedded (FFPE) tumor tissue blocks were obtained. MMR status was determined with immunohistochemistry as previously described [28]. Sections were stained with haematoxylin and eosin and prepared for pathological review. Tumor, polyp and histologically normal mucosa were macrodissected and processed independently. DNA was extracted with the QIAamp DNA FFPE Tissue kit following standard protocols (Qiagen, Hilden, Germany).
Tumor tissue sequencing and variant detection
CRC tumor tissue and matched blood-derived DNA from person 009 were prepared according to the procedure for Hybridization Capture using the Agilent SureSelectXT Low Input Clinical Research Exome v2 kit. The prepared libraries were sequenced with Illumina sequencing technology comprising 150 bp paired. Raw FASTQ files underwent adapter sequence trimming using trimmomatic v.0.38 [38] and alignment to the human genome reference GRCh37 using BWA v.0.7.12 [31]. Duplicate reads were identified with Picard v2.8.2. Mean on target coverage for the tumor and buffy coat samples was 499.3 and 79.5 respectively. Germline variants were called with HaplotypeCaller from GATK 4.0.0 [39] using GATK’s recommended workflow. Somatic single-nucleotide variants (SNVs) and short insertions and deletions (indels) were called with Mutect2 [40] with the recommended GATK practices and Strelka v.2.9.2 [41] with Illumina’s recommended workflow. Mutations reported by both callers were filtered to PASS variants with a minimum variant allele frequency of 0.1 and minimum depth of 50 reads.
Tumor loss of heterozygosity analysis
Two CRC and two polyp tissue DNA samples from two carriers of both variants were assessed for loss of heterozygosity (LOH) of the wildtype alleles of the BRCA1 and RNF43 variants using standard Sanger sequencing protocols. Short (179 bp) BRCA1 amplicons were generated using GCAGAAGAGGAATGTGCAACATTCT and TTATCTTTCTGACCAACCACAGGAA with sequencing occurring in the reverse direction. Short (182 bp) RNF43 amplicons were generated using ACAGGCTACTCAGGGTCAAATAGAT and CGAATGAGGTGGAGTCTTCGA with sequencing occurring in the forward direction. Tumor tissue DNA was available for a single CRC from person 009 for extended LOH assessment using WES tumor data. The captured regions of the genome were assessed for evidence of LOH by interrogating heterozygous germline variants in the tumor for their presence as homozygous reference or homozygous alternative in the tumor tissue. A tumor cellularity estimate of 80% was used. Germline variants with an allele frequency of between 0.4 and 0.6 were considered heterozygous. An allele frequency difference of 0.3 or greater in the somatic tissue, limited to variants with a germline depth ≥ 10 and tumor depth ≥ 30, was considered evidence of LOH. Individual variants suggesting the presence of LOH were aggregated to determine likely genomic regions of LOH. The algorithm used is available at https://github.com/supernifty/LOHdeTerminator.
Tumor mutational signature analysis
SNVs and indels were filtered to those in the capture region. These filtered SNVs and indels were used to calculate tumor mutational signatures according to the method given by SignatureEstimation [42] from the set of COSMIC version 3.2 signatures [43] limited to signatures observed in CRC tissue comprising 15 single base substitution (SBS) signatures and 5 indel (ID) signatures [44] as commonly recommended [45], including SBS3 and ID6 given their association with BRCA1 mutations. SBS3 or ID6 present at > 10% or > 20% proportion in the tumor signature profile, respectively, was considered positive for defective homologous recombination-based DNA damage repair (HRD).
Results
Two germline pathogenic variants were identified; one in BRCA1:c.2681_2682delAA, a frameshift pathogenic variant located in exon 10 encoding p.Lys894ThrfsTer8, and another in RNF43:c.988 C>T, a nonsense pathogenic variant located in exon 9 encoding p.Arg330Ter, in one family meeting the FCCTX criteria. The family pedigree with cancer-affected and carrier status is shown in Fig. 1. No other loss of function or predicted pathogenic variants were identified in established hereditary CRC and polyposis genes. Ten individuals carried the BRCA1:c.2681_2682delAA variant and eight individuals carried the RNF43:c.988 C>T variant. Seven individuals carried both pathogenic variants of whom six were cancer-affected (4 CRC, 1 breast/ovarian cancer, 1 metastatic cancer of unknown primary). All four of the CRC-affected relatives tested carried both pathogenic variants. Only a single carrier of both variants was cancer-unaffected at age 58 (person 026). Where both variants were tested, two individuals were found to carry only a single variant, person 018 carried only the BRCA1 variant and person 028 carried only the RNF43 variant, where each likely represents a separate homologous recombination event on chromosome arm 17q. Details of carrier status and their tumors are provided in Table 1.
The proband (person 001), a carrier of both the BRCA1 and RNF43 variants, was diagnosed with an adenocarcinoma of the caecum at age 53, a peritoneal cancer at age 62 and an ovarian cancer at age 63. MMR immunohistochemistry (IHC) of the metastatic lymph nodes indicated the CRC tumor was MMR-proficient. Three colonoscopies performed between the ages of 52 and 62 identified “numerous small metaplastic polyps” although the number and specific pathology were not reported, and, therefore, unclear if this person met the criteria for SPS. She died at age 67.
Two of the proband’s daughters (009 and 010) carried both the BRCA1 and RNF43 variants and both were CRC-affected. Person 009 was diagnosed with an MMR-proficient adenocarcinoma of the transverse colon at age 44. There was no report of synchronous polyps. Person 010 was diagnosed with a 15 mm moderately differentiated adenocarcinoma of the sigmoid colon at age 56, which appeared to have arisen from an SSL. Nine colonoscopy procedures between the ages of 40 and 63 revealed multiple serrated and adenomatous polyps. At the age of 56, a colonoscopy revealed a 10 mm hyperplastic polyp in the transverse colon in addition to the CRC. At the age of 59, a repeat colonoscopy showed a 6–8 mm adenomatous polyp and a 6–8 mm SSL in the ascending colon and two 6–8 mm hyperplastic polyps in the left colon. At the age of 62, a further colonoscopy showed a 5–8 mm hyperplastic polyp in the rectum. Including the SSL from which the adenocarcinoma had arisen from, person 010 met the 2019 WHO diagnostic criterion 1 for SPS [10].
Person 014 (a brother of the proband) was a carrier of the BRCA1 and RNF43 variants. He was diagnosed with an MMR-proficient adenocarcinoma of the transverse colon at age 56 and a prostate cancer at age 71. Person 018 (another brother of the proband) was a carrier of the BRCA1 variant but not the RNF43 variant. He was diagnosed with pharyngeal squamous cell carcinoma at age 57 and prostate adenocarcinoma at age 58. Two of the BRCA1 carriers developed breast cancer (persons 025 and 056), one of whom was diagnosed at 34 years of age; the subtype was unavailable.
Tumor analysis
The CRCs from persons 009 and 014 were both MMR-proficient by IHC, wildtype for BRAF p.V600 and KRAS codon 12 and 13 somatic mutations and were CIMP-negative (Table 2) suggesting they had not developed via the serrated pathway of tumorigenesis. The MMR-proficient CRC and contiguous SSL from person 010 were both BRAF p.V600E mutation positive and CIMP-high, consistent with development via the serrated pathway (Table 2). Sanger sequencing of the BRCA1 and RNF43 variants in the tubular adenoma, SSL and CRC from person 010 showed evidence of LOH of the wildtype allele for both variants in the SSL and adenocarcinoma but not the tubular adenoma (Table 2; Fig. 2).
To further investigate tumor etiology, the CRC from person 009 underwent WES. No somatic mutations in BRCA1 and RNF43 were observed, however, loss of the wildtype allele was evident for both variants. LOH of a larger region across chromosome arm 17q was detected that included the BRCA1 and RNF43 genes (Fig. 3). Analysis of COSMIC tumor mutational signature profiles revealed SBS3 (61.8%), SBS1 (11.3%) and SBS30 (8.9%) as the SNV-derived signatures with the highest proportion. The observed indels in this tumor were decomposed into the signatures ID6 (65.2%), ID5 (30.5%) and ID1 (4.3%), with the predominance of both SBS3 and ID6 indicative of defective homologous recombination-based DNA damage repair (HRD); the contexts of SBS3 and ID6 are compared to those observed in 009 in Fig. 4.
The top plot covers the whole of chromosome 17. The middle plot covers a region around BRCA1. The bottom plot covers a region around RNF43.
Discussion
This study identifies a family meeting the criteria for FCCTX where a germline BRCA1:c.2681_2682delAA p.Lys894ThrfsTer8 pathogenic variant and a germline RNF43:c.988 C>T p.Arg330Ter pathogenic variant co-segregated with CRC in four carriers, one of whom was confirmed to meet the WHO2019 diagnostic criteria 1 for SPS. Tumor analysis demonstrated loss of the wildtype allele for both variants in the two CRCs tested. As both BRCA1 and RNF43 reside on chromosome 17q, the LOH observed across the region encompassing both these tumor suppressor genes (Fig. 3) confirms that both BRCA1 and RNF43 had biallelic inactivation. The presence of both the tumor mutational signatures SBS3 and ID6 at high levels (> 50%), which is associated with HRD, and the absence of serrated pathway molecular characteristics, namely the BRAF p.V600E mutation and CIMP-high, suggests that tumorigenesis for the CRC from person 009 was driven by HRD deficiency related to BRCA1 inactivation. In contrast, biallelic inactivation of BRCA1 and RNF43 was also present in the CRC from person 010 with the tumor demonstrating characteristics of the serrated pathway (BRAF p.V600E mutation and high levels of CIMP), suggesting that for this tumour tumorigenesis may have been driven by RNF43 deficiency.
Germline pathogenic variants in BRCA1 predispose carriers to significantly elevated risks of breast and ovarian cancers [46], but the relationship between BRCA1 and CRC susceptibility is less clear [22]. A recent meta-analysis and systematic review showed BRCA1 and/or BRCA2 pathogenic variant carriers did not have a higher risk of developing CRC [47]. Past studies have suggested BRCA2 may underlie CRC development in FCCTX families, however, there is little evidence implicating BRCA1 [48, 49]. In the current study, ten family members carried the BRCA1 variant, four developing CRC with only three developing a breast or ovarian cancer. Tumor WES derived analysis from the single CRC from person 009 demonstrated that tumorigenesis was dominated by the BRCA1 variant-related HRD process, evidenced by the high proportion of HRD-related SBS3 and ID6 mutational signatures. Despite this, it is possible that RNF43 deficiency has also contributed to the initiation and/or progression of tumorigenesis in this person together with HRD.
Somatic mutations in RNF43 play a role in colorectal tumorigenesis including in the serrated pathway [50,51,52,53,54]. Furthermore, although rare in SPS [19], several studies have now provided evidence that germline RNF43 variants are associated with SPS [14,15,16,17,18,19, 53]. Only a few of these studies have investigated segregation of the RNF43 variant with SPS in the family. Of note, a study by Taupin et al. [15] identified a germline nonsense variant in RNF43 (c.394 C>T p.Arg132Ter) in two siblings affected with SPS, one developed CRC and a study by Yan et al. [17] identified a germline splice site variant (c.953-1 G>A) in RNF43 carried by six people from the family. Five of the six carriers met the WHO2010 criteria for SPS with a second somatic hit in RNF43 (predominantly LOH) identified in all 22 cancers/polyps analyzed [17]. There were eight carriers of the RNF43:c.988 C>T p.Arg330Ter variant in the family from this study, four were CRC-affected and a single carrier was confirmed to meet the WHO2019 criteria for SPS. Furthermore, LOH was observed as the second somatic hit in both CRCs tested and in an SSL polyp. [16, 17] Our findings add further support for the association between germline RNF43 variants and susceptibility to SPS and CRC.
Tumor mutational signature analysis is an important tool for understanding tumor etiology and for predicting response to cancer therapies, including the use of PARP inhibitors for cancers with HRD [55]. Of the current COSMIC mutational signatures, SBS3 and ID6 are associated with HRD, which are associated with defects in BRCA1, BRCA2 or other genes involved in the homologous recombination pathway [55, 56], although HRD in CRC is not commonly observed [57]. In the CRC from person 009, both SBS3 and ID6 were the dominant mutational signatures, supporting HRD related to the germline BRCA1 variant.
This study has several limitations. Phenotype data was not available from all family members including incomplete or historic colonoscopy and/or pathology reports that meant some of the colonic polyp number and morphological classification was not definitive or equivalent to contemporary polyp classification. Little data was obtained from earlier generations as those generations were deceased prior to commencing a detailed investigation. Furthermore, the tumor tissue for molecular testing was limited with only a single CRC with sufficient DNA for WES and therefore, confirmation that HRD associated mutational signatures were the dominant mutational process in the other CRCs from BRCA1 carriers could not be determined. Further investigation of HRD in CRC tumorigenesis is needed.
Conclusion
In summary, we have identified coinheritance of pathogenic germline variants in BRCA1 and RNF43 segregating with CRC in a family previously characterized as FCCTX. One individual satisfied the diagnostic criteria for SPS, and there was evidence for a somatic second-hit in BRCA1 and RNF43 in the form of LOH. Bioinformatic analysis showed that the tumorigenesis was predominantly driven by the BRCA1 variant with LOH, as indicated by the HRD-related mutational signatures in the tumor. Our study highlights a possible role of digenic inheritance underlying FCCTX.
References
Lichtenstein P, Holm NV, Verkasalo PK, Iliadou A, Kaprio J, Koskenvuo M et al (2000) Environmental and heritable factors in the causation of Cancer — analyses of cohorts of twins from Sweden, Denmark, and Finland. N Engl J Med 343(2):78–85
Lorans M, Dow E, Macrae FA, Winship IM, Buchanan DD (2018) Update on Hereditary Colorectal Cancer: improving the clinical utility of Multigene Panel Testing. Clin Colorectal Cancer 17(2):e293–e305
Vasen HF, Mecklin JP, Khan PM, Lynch HT (1991) The International Collaborative Group on Hereditary Non-polyposis Colorectal Cancer (ICG-HNPCC). Dis Colon Rectum 34(5):424–425
Shiovitz S, Copeland WK, Passarelli MN, Burnett-Hartman AN, Grady WM, Potter JD et al (2014) Characterisation of familial Colorectal cancer type X, Lynch syndrome, and non-familial Colorectal cancer. Br J Cancer 111(3):598–602
Lindor NM, Rabe K, Petersen GM, Haile R, Casey G, Baron J et al (2005) Lower Cancer incidence in Amsterdam-I criteria families without Mismatch Repair Deficiency: familial Colorectal Cancer type X. JAMA 293(16):1979–1985
Zetner DB, Bisgaard ML (2017) Familial Colorectal Cancer type X. Curr Genomics 18(4):341–359
Carballal S, Rodríguez-Alcalde D, Moreira L, Hernández L, Rodríguez L, Rodríguez-Moranta F et al (2016) Colorectal cancer risk factors in patients with serrated polyposis syndrome: a large multicentre study. Gut 65(11):1829–1837
JE IJ, Rana SA, Atkinson NS, van Herwaarden YJ, Bastiaansen BA, van Leerdam ME et al (2017) Clinical risk factors of Colorectal cancer in patients with serrated polyposis syndrome: a multicentre cohort analysis. Gut 66(2):278–284
Rosty C, Parry S, Young JP (2011) Serrated polyposis: an enigmatic model of Colorectal Cancer Predisposition. Patholog Res Int 2011:157073–157013
Rosty C, Brosens L, Dekker E, Nagtegaal ID (2019) WHO Classification of Tumours of the Digestive System: Serrated polyposis.
Pai RK, Bettington M, Srivastava A, Rosty C (2019) An update on the morphology and molecular pathology of serrated colorectal polyps and associated carcinomas. Mod Pathol 32(10):1390–1415
Heald B, Hampel H, Church J, Dudley B, Hall MJ, Mork ME et al (2020) Collaborative Group of the Americas on inherited gastrointestinal Cancer position statement on multigene panel testing for patients with Colorectal cancer and/or polyposis. Fam Cancer 19(3):223–239
Clendenning M, Young JP, Walsh MD, Woodall S, Arnold J, Jenkins M et al (2013) Germline mutations in the polyposis-Associated genes BMPR1A, SMAD4, PTEN, MUTYH and GREM1 are not common in individuals with serrated polyposis syndrome. PLoS ONE 8(6):e66705
Gala MK, Mizukami Y, Le LP, Moriichi K, Austin T, Yamamoto M et al (2014) Germline mutations in oncogene-induced senescence pathways are associated with multiple sessile serrated adenomas. Gastroenterology 146(2):520–529
Taupin D, Lam W, Rangiah D, McCallum L, Whittle B, Zhang Y et al (2015) A deleterious RNF43 germline mutation in a severely affected serrated polyposis kindred. Hum Genome Var 2:15013
Quintana I, Mejías-Luque R, Terradas M, Navarro M, Piñol V, Mur P et al (2018) Evidence suggests that germline RNF43 mutations are a rare cause of serrated polyposis. Gut 67(12):2230–2232
Yan HHN, Lai JCW, Ho SL, Leung WK, Law WL, Lee JFY et al (2017) RNF43 germline and somatic mutation in serrated neoplasia pathway and its association with BRAF mutation. Gut 66(9):1645–1656
Mikaeel RR, Young JP, Li Y, Poplawski NK, Smith E, Horsnell M et al (2022) RNF43 pathogenic germline variant in a family with Colorectal cancer. Clin Genet 101(1):122–126
Buchanan DD, Clendenning M, Zhuoer L, Stewart JR, Joseland S, Woodall S et al (2017) Lack of evidence for germline RNF43 mutations in patients with serrated polyposis syndrome from a large multinational study. Gut 66(6):1170–1172
Moynahan ME, Chiu JW, Koller BH, Jasin M (1999) Brca1 controls homology-directed DNA repair. Mol Cell 4(4):511–518
Kuchenbaecker KB, Hopper JL, Barnes DR, Phillips KA, Mooij TM, Roos-Blom MJ et al (2017) Risks of breast, ovarian, and contralateral Breast Cancer for BRCA1 and BRCA2 mutation carriers. JAMA 317(23):2402–2416
Sopik V, Phelan C, Cybulski C, Narod SA (2015) BRCA1 and BRCA2 mutations and the risk for Colorectal cancer. Clin Genet 87(5):411–418
Phelan CM, Iqbal J, Lynch HT, Lubinski J, Gronwald J, Moller P et al (2014) Incidence of Colorectal cancer in BRCA1 and BRCA2 mutation carriers: results from a follow-up study. Br J Cancer 110(2):530–534
Thompson D, Easton DF (2002) Cancer incidence in BRCA1 mutation carriers. J Natl Cancer Inst 94(18):1358–1365
Morak M, Massdorf T, Sykora H, Kerscher M, Holinski-Feder E (2011) First evidence for digenic inheritance in hereditary Colorectal cancer by mutations in the base excision repair genes. Eur J Cancer 47(7):1046–1055
Schubert SA, Ruano D, Tiersma Y, Drost M, de Wind N, Nielsen M et al (2020) Digenic inheritance of MSH6 and MUTYH variants in familial Colorectal cancer. Genes Chromosomes Cancer 59(12):697–701
Ciavarella M, Miccoli S, Prossomariti A, Pippucci T, Bonora E, Buscherini F et al (2018) Somatic APC mosaicism and oligogenic inheritance in genetically unsolved colorectal adenomatous polyposis patients. Eur J Hum Genet 26(3):387–395
Buchanan DD, Clendenning M, Rosty C, Eriksen SV, Walsh MD, Walters RJ et al (2017) Tumor testing to identify lynch syndrome in two Australian Colorectal cancer cohorts. J Gastroenterol Hepatol 32(2):427–438
Jenkins MA, Win AK, Templeton AS, Angelakos MS, Buchanan DD, Cotterchio M et al (2018) Cohort Profile: the Colon Cancer Family Registry Cohort (CCFRC). Int J Epidemiol 47(2):387–8i
Newcomb PA, Baron J, Cotterchio M, Gallinger S, Grove J, Haile R et al (2007) Colon Cancer Family Registry: an international resource for studies of the genetic epidemiology of colon Cancer. Cancer Epidemiol Biomarkers Prev 16(11):2331–2343
Li H, Durbin R (2010) Fast and accurate long-read alignment with Burrows-Wheeler transform. Bioinformatics 26(5):589–595
Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N et al (2009) The sequence Alignment/Map format and SAMtools. Bioinformatics 25(16):2078–2079
McKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K, Kernytsky A et al (2010) The genome analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res 20(9):1297–1303
DePristo MA, Banks E, Poplin R, Garimella KV, Maguire JR, Hartl C et al (2011) A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat Genet 43(5):491–498
Li H (2011) A statistical framework for SNP calling, mutation discovery, association mapping and population genetical parameter estimation from sequencing data. Bioinformatics 27(21):2987–2993
McLaren W, Gil L, Hunt SE, Riat HS, Ritchie GR, Thormann A et al (2016) The Ensembl variant effect predictor. Genome Biol 17(1):122
Rentzsch P, Witten D, Cooper GM, Shendure J, Kircher M (2019) CADD: predicting the deleteriousness of variants throughout the human genome. Nucleic Acids Res 47(D1):D886–d94
Bolger AM, Lohse M, Usadel B (2014) Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30(15):2114–2120
Poplin R, Ruano-Rubio V, Depristo MA, Fennell TJ, Carneiro MO, Geraldine AVDA et al (2018) Scaling accurate genetic variant discovery to tens of thousands of samples. Cold Spring Harbor Laboratory Press, Cold Spring Harbor
Cibulskis K, Lawrence MS, Carter SL, Sivachenko A, Jaffe D, Sougnez C et al (2013) Sensitive detection of somatic point mutations in impure and heterogeneous cancer samples. Nat Biotechnol 31(3):213–219
Kim S, Scheffler K, Halpern AL, Bekritsky MA, Noh E, Källberg M et al (2018) Strelka2: fast and accurate calling of germline and somatic variants. Nat Methods 15(8):591–594
Huang X, Wojtowicz D, Przytycka TM (2018) Detecting presence of mutational signatures in cancer with confidence. Bioinformatics 34(2):330–337
Tate JG, Bamford S, Jubb HC, Sondka Z, Beare DM, Bindal N et al (2019) COSMIC: the catalogue of somatic mutations in Cancer. Nucleic Acids Res 47(D1):D941–d7
Alexandrov LB, Kim J, Haradhvala NJ, Huang MN, Tian Ng AW, Wu Y et al (2020) The repertoire of mutational signatures in human cancer. Nature 578(7793):94–101
Koh G, Degasperi A, Zou X, Momen S, Nik-Zainal S (2021) Mutational signatures: emerging concepts, caveats and clinical applications. Nat Rev Cancer 21(10):619–637
Narod SA, Foulkes WD (2004) BRCA1 and BRCA2: 1994 and beyond. Nat Rev Cancer 4(9):665–676
Cullinane CM, Creavin B, O’Connell EP, Kelly L, O’Sullivan MJ, Corrigan MA et al (2020) Risk of Colorectal cancer associated with BRCA1 and/or BRCA2 mutation carriers: systematic review and meta-analysis. Br J Surg 107(8):951–959
Garcia FAO, de Andrade ES, de Campos Reis Galvão H, da Silva Sábato C, Campacci N, de Paula AE et al (2022) New insights on familial Colorectal cancer type X syndrome. Sci Rep 12(1):2846
Garre P, Martín L, Sanz J, Romero A, Tosar A, Bando I et al (2015) BRCA2 gene: a candidate for clinical testing in familial Colorectal cancer type X. Clin Genet 87(6):582–587
Giannakis M, Hodis E, Jasmine Mu X, Yamauchi M, Rosenbluh J, Cibulskis K et al (2014) RNF43 is frequently mutated in colorectal and endometrial cancers. Nat Genet 46(12):1264–1266
Bond CE, McKeone DM, Kalimutho M, Bettington ML, Pearson SA, Dumenil TD et al (2016) RNF43 and ZNRF3 are commonly altered in serrated pathway colorectal tumorigenesis. Oncotarget 7(43):70589–70600
Tsai JH, Liau JY, Yuan CT, Lin YL, Tseng LH, Cheng ML et al (2016) RNF43 is an early and specific mutated gene in the serrated pathway, with increased frequency in traditional serrated adenoma and its Associated Malignancy. Am J Surg Pathol 40(10):1352–1359
van Herwaarden YJ, Koggel LM, Simmer F, Vink-Börger EM, Dura P, Meijer GA et al (2021) RNF43 mutation analysis in serrated polyposis, sporadic serrated polyps and Lynch syndrome polyps. Histopathology 78(5):749–758
Fennell LJ, Clendenning M, McKeone DM, Jamieson SH, Balachandran S, Borowsky J et al (2018) RNF43 is mutated less frequently in Lynch Syndrome compared with sporadic microsatellite unstable colorectal cancers. Fam Cancer 17(1):63–69
Póti Á, Gyergyák H, Németh E, Rusz O, Tóth S, Kovácsházi C et al (2019) Correlation of homologous recombination deficiency induced mutational signatures with sensitivity to PARP inhibitors and cytotoxic agents. Genome Biol 20(1):240
Stok C, Kok YP, van den Tempel N, van Vugt M (2021) Shaping the BRCAness mutational landscape by alternative double-strand break repair, replication stress and mitotic aberrancies. Nucleic Acids Res 49(8):4239–4257
Moretto R, Elliott A, Zhang J, Arai H, Germani MM, Conca V et al (2022) Homologous recombination Deficiency alterations in Colorectal Cancer: clinical, molecular, and prognostic implications. J Natl Cancer Inst 114(2):271–279
Acknowledgements
We thank the members of the Colorectal Oncogenomics Group for their support of this manuscript. We thank the participants and staff from the Australasian Colorectal Cancer Family Registries (ACCFR) and especially thank Allyson Templeton, Maggie Angelakos, and Samantha Fox for supporting this study. We thank the Australian Genome Research Facility and Melbourne Bioinformatics for their collaboration and support of this work.
Funding
The design, analysis and interpretation of data for this study was supported by a Cancer Council Victoria project grant (PI Winship). DDB is supported by an NHMRC Investigator grant (GNT1194896) and University of Melbourne Dame Kate Campbell Fellowship. RW is supported by Lynch syndrome Australia. PG is supported by Cancer Council of Victoria Fellowship. MAJ is supported by an NHMRC Investigator grant (GNT1195099). Research reported in this publication was supported by the National Cancer Institute of the National Institutes of Health under Award Number U01CA167551 and through a cooperative agreement with the Australasian Colorectal Cancer Family Registry (NCI/NIH U01 CA074778 and U01/U24 CA097735) and by the Victorian Cancer Registry, Australia. The content of this manuscript does not necessarily reflect the views or policies of the National Cancer Institute or any of the collaborating centres in the Colon Cancer Family Registry (CCFR), nor does mention of trade names, commercial products, or organizations imply endorsement by the US Government or the CCFR.
Author information
Authors and Affiliations
Contributions
D.D.B., M.C., F.A.M., I.M.W., and M.A.J. conceived the project and designed the study and analysis. S.J., M.C., P.G., K.M., J.E.J., R.W., J.C., S.P., S.M.C., Y.C. A.L.M., B.J.P., D.D., C.R., M.A.J. and D.D.B. contributed to the acquisition of study data. J.M.C., M.C., P.G., K.M., J.E.J., R.W., J.C., S.P. and D.D.B. contributed to the analysis of the data. J.M.C. and D.D.B. drafted the manuscript. All authors provided critical revision of the manuscript and approved the final version.
Corresponding author
Ethics declarations
Conflicts of interests
The authors report there are no conflicts of interests to be declared.
Additional information
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Chan, J.M., Clendenning, M., Joseland, S. et al. Inherited BRCA1 and RNF43 pathogenic variants in a familial colorectal cancer type X family. Familial Cancer 23, 9–21 (2024). https://doi.org/10.1007/s10689-023-00351-2
Received:
Accepted:
Published:
Issue Date:
DOI: https://doi.org/10.1007/s10689-023-00351-2