Abstract
Bioeconomy goals for using biomass feedstock for biofuels and bio-based production has arisen the demand for fungal strains and enzymes for biomass processing. Despite well-known Trichoderma and Aspergillus commercial strains, continuous bioprospecting has revealed the fungal biodiversity potential for production of biomass degrading enzymes. The strain Aspergillus fumigatus LMB-35Aa has revealed a great potential as source of lignocellulose-degrading enzymes. Nevertheless, genetic improvement should be considered to increase its biotechnological potential. Molecular manipulation based on homologous direct recombination (HDR) in filamentous fungi poses a challenge since its low recombination rate. Currently, CRISPR/Cas9-mediated mutagenesis can enable precise and efficient editing of filamentous fungi genomes. In this study, a CRISPR/Cas9-mediated gene editing strategy for improving endoglucanase activity of A. fumigatus LMB-35Aa strain was successfully used, which constitutes the first report of heterologous cellulase production in filamentous fungi using this technology. For this, eglA gene from A. niger ATCC 10,864 was integrated into conidial melanin pksP gene locus, which facilitated the selection of edited events discerned by the emergence of albino colonies. Heterologous production of the EglA enzyme in a biofilm fermentation system resulted in a 40% improvement in endoglucanase activity of the mutant strain compared to the wild type.
Similar content being viewed by others
Introduction
Bioeconomy has emerged as a novel economic and sustainability paradigm to replace the use of nonremovable resources by promoting feedstock conversion into biofuels and several bioproducts. Feedstock processing in biorefineries, has driven the search for new sources of enzymes and more efficient production strategies1,2,3.Among fungi, Trichoderma reesei RUT C-30 is the most used since it hyper secretes biomass-degrading enzymes for several industrial applications, but also is well known for their long genetic improving history4. Another cellulase producers include species from Penicillium, Aspergillus, and Trichoderma5. However, bioprospecting for novel fungal species and secretomes as sources of single enzymes or cellulase cocktails is needed6,7. In that sense, A. fumigatus, are also being investigated for their biotechnological potential for enzyme prodution8. A. fumigatus stands out as producer of cellulases, xylanases, and ligninases, for processing lignocellulosic compounds from plant materials9,10,11, making it an attractive candidate for enzyme production. A noteworthy case is A. fumigatus LMB-35Aa, an alkaline cellulase producing saprophytic strain isolated from Peruvian rainforest soil, which is considered safe due to the absence of certain virulence-related genes found in clinical strains12,13. However, identification and characterization of these kind of cellulases in this strain has not been deeply investigated.
Several strategies have been developed to improve production yield and catalytic efficiency of cellulolytic fungal enzymes. For instance, surface adhesion fermentation (SAF)14, such as those mediated by biofilms, have shown to enhance productivity in A. niger ATCC10864 strain15. Additionally, conventional genetic manipulation, including random mutagenesis, have been successfully employed to obtain hypersecreting mutants such as Trichoderma reesei RUT-C304 as well as Aspergillus species16,17. Site-directed mutagenesis has also considered for catalytic enhancement of cellulolytic enzymes18,19,20.
Also, heterologous production of modified enzymes is usually required, making it a challenge to produce the complete set of cellulases. Heterologous production of cellulases in bacterial or yeast host could be limited because of incorrect folding, N- and O-glycosylation, and inefficient secretion21,22. Hence, the development of an optimized heterologous expression system for complete lignocellulose degradation remains a costly and labor-intensive process.
Alternatively, the insertion of cellulases into the fungal genomes has been explored22,23,24. However, this approach is limited by random gene integration or by the low homologous recombination rate mediated by long arms in the insertion cassette for gene disruption. Consequently, the low selection rate of disruptive events hinders the identification of a sufficient number of transformants through homologous integration of a gene cassette25,26. Therefore, the development of new strategies to meet the growing demand for cellulolytic enzymes in various industries is crucial.
In this context, precise methods for introducing genetic modifications in fungi are required to improve cellulase production through genetic engineering. The CRISPR/Cas9 gene editing system has emerged as a highly efficient tool for targeted genetic recombination of filamentous fungi27,28,29, including non-models strains or those that have not been molecularly characterized30,31. Despite the homologous direct recombination (HDR) or non-homologous end-joining (NHEJ) repair pathways, an alternative independent mechanism, termed Microhomology-Mediated End Joining (MMEJ), has been already described in A. fumigatus31. Indeed, gene editing studies in A. fumigatus have primarily focused on genes related to pathogenicity using clinical and commercial isolates such as Af293 and CEA1032. The CRISPR/Cas9 system relies on the use of a complex, formed by an endonuclease (Cas9) and a single guide RNA molecule (sgRNA), which directs the complex to its target sequence and allows the endonuclease to cut at a specific point in the fungal genome33. The high efficiency of CRISPR/Cas9 in genetic recombination, and its potential to generate mutant strains both through gene knock-out and by knock-in make it a valuable tool for optimizing enzymatic production in non-model filamentous fungi27,28,29,34. A. fumigatus possess a predominant NHEJ repair system, making HDR less efficient. Knockout strains of the aku80 gene have been developed to address this, achieving gene deletion rates of 46 to 74% using 35–50 bp homology regions, compared to low gene targeting efficiencies (5–20%) with classical genetic manipulation methods35.
CRISPR/Cas technology has already been used for heterologous expression of different cellulases in Saccharomyces cerevisiae36,37, as well as for improvement of cellulase production38,39,40,41,42,43 or to produce various secondary metabolites in filamentous fungi44,45. Although heterologous expression could facilitate the obtention of enzymatic cocktails by genomic design, currently, there are no reports of gene editing for heterologous cellulase production in Aspergillus and related genera. Therefore, in this study the CRISPR/Cas9 system was used to achieve the heterologous production of endoglucanase EglA from the fungus A. niger ATCC 10,864 in the A. fumigatus LMB-35Aa wild-type strain. EglA is an endoglucanase enzyme, known for its activity at an optimally pH of 546, which aligns with the optimal pH range for A. fumigatus LMB-35Aa under the conditions used in this study13. To facilitate the selection process of knock-in events through the identification of albino colonies, eglA gene was integrated through the MMEJ pathway into the conidial melanin pksP gene locus.
Results
Construction of CRISPR/Cas9 vector and gene cassettes for targeted mutagenesis of A. fumigatus
For this study, the pksP gene was chosen as target because it is responsible for conidial pigmentation and induces albino colony formation upon its loss of function31,47. The strategy used to efficiently deliver both the sgRNA and the Cas9 protein to the pksP target locus closely followed the approach used by Nødvig30. For this purpose, the pJB112 vector was designed, which incorporates cas9 and pksP gRNA sequences, regulated by the Aspergillus nidulans tef1 and gpdA promoters, respectively. To generate the gRNA cassette, pksP gRNA was fused with the Hammerhead (HH) and hepatitis delta virus (HDV) ribozymes from the pFC334 vector and subsequently ligated it into the pFC332 vector (see Fig. 1 for details).
Integration cassettes of gfp and eglA genes (~ 2000 bp) were generated by fusion PCR and contained the trpC promoter and terminator flanked by 39 nt at its 5´and 3´ends that are homologous to the adjacent ends of the cut site.
Inactivation of pks P gene in the native A. fumigatus LMB-35Aa strain by CRISPR/Cas9 targeted mutagenesis
To validate the effectiveness of gene edition into pksP target site, a first attempt to transform A. fumigatus LMB-35Aa protoplasts only with the pJB112 vector was done. At about 55 (10.22%) of the regenerated colonies exhibited an albino phenotype (Fig. 2) and 9 of these were selected for further verification of targeted mutagenesis. Sequencing of PCR fragments covering the genomic region adjacent to the Cas9 cleavage site revealed four different mutations (Fig. 3). Mutation 1 consisted of a large insertion of 88 nucleotides, generating a stop codon near the cutting site. Interestingly, the insertion exhibited by this mutant corresponded to the AMA1 region of the pFC332 plasmid. The three remaining mutations consisted of small indels: mutant 2 showed a cytosine deletion, mutant 3 a Thymine insertion, and mutant 4 a deletion of 5 nucleotides. All of them have a reading frame shift generating a stop codon near the cutting site, which explain pksP loss of function.
It should be mentioned that no sequences matching the pksP protospacer-PAM were identified within the plasmid pFC332, which harbor the AMA1 sequence, that could potentially be cleaved by the sgRNA-Cas9 rib onucleoprotein complex.
Knock-in of exogenous genes into pks P gene locus of A. fumigatus LMB-35Aa by CRISPR/Cas9 targeted mutagenesis
To obtain knock-in mutants, two separated co-transformations of A. fumigatus LMB-35Aa wild-type strain were carried out with vector pJB112 and each integration cassettes (gfp or eglA). The first one carried the green fluorescent protein (GFP) gene as reporter to validate the edition, while the second one contained an A. niger endoglucanase gene (eglA) aimed at enhancing the endoglucanase activity of A. fumigatus LMB-35Aa.
Albino colonies were evaluated under a phase-contrast microscope showing typical conidiophore and hypha structures (Fig. 4a). Also, fluorescence microscopy revealed GFP expression in twelve co-transformed albino colonies with a fluorescence pattern distributed throughout the hypha and conidiophores, except in the vacuoles (Fig. 4b). Subsequently, to confirm the insertion of the gfp gene at the pksP target site (Fig. 5), these mutants were assessed by PCR using primers that flank the Cas9 cleavage site as shown in (Fig. 5). Among the twelve evaluated clones, only one of them (LMB072) amplified the fragment of expected size (~ 2000 bp), which contains gfp cassette integrated at the Cas9 cleavage site; the remaining clones showed amplicon sizes of around 500 bp, similar to the wild-type strain (Supplementary Fig. S1). However, the integration of gfp cassette in the genomes of these edited strains was also confirmed by PCR (~ 800 bp) (Supplementary Fig. S1).
For eglA cassette, after A. fumigatus LMB-35Aa co-transformation, thirteen albino colonies were isolated and evaluated by PCR by employing primers that flank the Cas9 cleavage site as shown in (Fig. 5). The fragment of the expected size (~ 2000 bp), which contains eglA cassette integrated at the Cas9 cleavage site, was amplified in only three of the clones evaluated; however, two of these clones also exhibited several non-specific bands. As observed in the case of gfp cassette integration, amplicons showing sizes like the wild-type strain (~ 500 bp) were also obtained. Likewise, the integration of eglA gene in the genomes of these edited strains was also confirmed by amplifying the Open Reading Frame (ORF) of this gene by PCR and the clone which exhibited only bands of the expected sizes in both amplifications (LMB073) was selected for further biochemical assays (Supplementary Fig. S2).
Additionally, to identify putative off-target sites that would explain the nonspecific integration of gfp or eglA genes, a comprehensive in silico analysis was performed. The results revealed the absence of off-target sites both 1 kb upstream and downstream of the target A. fumigatus LMB-35Aa pksP sequence. Nevertheless, a sequence (ACGCTATTCCCGCGG) exhibiting the protospacer-PAM match was identified 100 kb downstream of the target sequence, although with one mismatch (in bold).
Effect of the eglA gene expression on A. fumigatus LMB-35Aa endoglucanase activity
Once the successful integration of eglA cassette in knock in edited mutant strains was confirmed (Supplementary Fig. S2), eglA gene expression was validated by using RT-PCR of A. fumigatus LMB073 mutant strain (Supplementary Fig. S3). Subsequently, this selected knock in strain was cultivated in a biofilm system, using carboxymethyl cellulose (CMC) as a substrate to induce cellulase production. Notably, the specific endoglucanase activity exhibited by the LMB073 strain (94.89 ± 8.1 U/g) was ~ 40% higher (26.89 U/g) than the wild-type strain (68 ± 4.6 U/g) (Student’s t test, p-value < 0.05).
Discussion
Bioeconomy scenario has emerged for sustainable production of biofuels and biproducts from renewable resources, mainly lignocellulose, stressing the need to obtain novel enzymes or enzymatic cocktail sources, that included cellulases and other biomass degrading enzymes48. Complementarly different approaches has been used for strain improvement to produce cellulases, that include genetic and metabolic engineering, mutagenesis, omics and genomic engineering, and CRISPR system49,50.
Currently, the CRISPR/Cas9-mediated mutagenesis has revolutionized genetic manipulation through the development of versatile methods to precisely achieve gene disruptions and gene replacements in a wide range of filamentous fungi28,29,30,34. Despite some limitations such as incomplete gene annotation of the target strain, potential off-target effects, and/or low efficiency of detection and cleavage of the sgRNA, the application of the CRISPR/Cas9 mutagenesis system still constitutes a very promising tool for precise and efficient gene editing in non-model fungi29,30,32, with valuable applications in diverse fields such as the development of antifungal agents, production of natural compounds, enzymes, and optimization of fermentation processes28,29,45,51.
Although successful applications of CRISPR/Cas9 gene editing have been achieved in fungi, there are currently limited reports on its use for cellulase heterologous expression or cellulase production enhancement29,32,39,40,41,43,51,52. In this study, we aimed to address this gap by using the CRISPR/Cas9 system to edit A. fumigatus LMB-35Aa strain and inserting the exogenous eglA endoglucanase gene. This genetic modification was combined with a biofilm fermentation system, which is considered suitable for enhancing cellulase production in A. niger15, to promote higher cellulase production in the edited mutants.
While biofilm formation is commonly associated with infection processes and fungal pathogenicity53, it has also been described in the case of opportunistic A. fumigatus clinical strains in immunosuppressed patients53,54,55. However, an expression analysis of pathogenicity-related genes of the non-clinical strain used in this study revealed that virulence is influenced by multiple factors beyond biofilm formation and growth temperature13. This underscores the complexity of fungal pathogenicity and the specific characteristics of the non-clinical strain used in this study.
With the aim of editing the A. fumigatus LMB-35Aa genome, the vector pJB112 with the AMA1 sequence, which has been shown to be an efficient replication origin in many fungal species56,57, and the hygromycin resistance gene (hygR) as a selection marker, was designed and constructed . The pksP gene involved in the coloring of the A. fumigatus conidia, was selected as the target gene, which facilitated the phenotypic identification of albino edited mutants31,47 and allowed a successful gene edition with a ~10 % efficiency. Previous work in A. fumigatus has reported gene editing efficiencies from 25 to 53 % using the same protospacer (target) sequence31,47; while in other gene editing attempts in diverse Aspergillus species, targeting genes such as wA, yA and pyrG, the efficiencies have varied widely (10–100%)30,58,59,60. However, it is worth noting that the 100% editing efficiency reported for the yA gene was calculated based on only the three obtained transformants58. Furthermore, Nødvig et al. (2018) improved it editing efficiency by adding long homology arms61. Additionally, different gene editing efficiencies (10-44 %) have been reported in Trichoderma reesei39,41,51, Penicillium oxalicum41, Talaromyces pinohpilus40 and Rasamsonia emersonii43 by knocking-out cellulase transcriptional regulators such as ace1 and cre1, as well as by introducing additional copies of the xyr1 regulator gene with the aim of enhancing cellulase production. Apparently, the ploidy level is another crucial factor that could also affect editing efficiency, being lower in multinuclear fungi30,58,59,62.
Notably, the ~40 % increase of endoglucanase activity obtained with the eglA knock-in edited mutant LMB073 (Fig. 6) surpasses the improvements reported by other authors using CRISPR/Cas9 technology. For instance, Singh et al.43 achieved a 22 % increase in R. emersonii by knocking-out the ace1 gene43; while Zhang et al.51 only achieved between 4 and 7 % increase by knocking-in a xyr1 gene into the ace1 locus in T. reesei51. Our findings indicate that even though previous studies used regulatory genes to improve cellulase production, the increase in activity was not as significant as observed in this study. Therefore, this study represents the first report of successful improvement of endoglucanase activity in Aspergillus by knocking-in an exogenous gene (eglA) through CRISPR/Cas9 mediated targeted mutagenesis, highlighting its potential as a source of cellulases or enzymatic cocktails by genomic design, and setting a new benchmark for further improvement of LMB-35Aa strain.
Although apparently gene cassettes could be integrated into an alternative genomic locus of A. fumigatus, this could be due to a non-specific integration of the expression cassette via NHEJ, but also because of potential off-target effects. In fact, off-target effects constitute a potential limitation associated with CRISPR/Cas9 technology, particularly in eukaryotic organisms. However, no putative off-target sites were found in the regions 1 kb up- and downstream of the target pksP sequence in A. fumigatus LMB-35Aa genome, but a sequence of 15 nucleotides exhibiting only one mismatch with the protospacer-PAM sequence was identified 100 kb downstream. Whether this region could have been the nonspecific insertion site will need to be confirmed by PCR and further sequencing.
On the other hand, regarding the insertion of 88 nucleotides detected in one of the knock-out edited strains (mutant 1), which corresponded to the AMA1 region in pFC332 plasmid, it could be attributed to the cleavage mediated by the sgRNA-Cas9 ribonucleoprotein complex. Nonetheless, not founded sequences matching the pksP protospacer-PAM within the pFC332 sequence, strongly suggests that the 88 bps AMA1 sequence inserted in that mutant was not due to an additional RNA-guided Cas9 activity at these loci on pFC332 plasmid.
It is also well known that gene manipulation in filamentous fungi is constrained by the low efficiency of homologous recombination in DNA-mediated transformation and the high frequency of ectopic integrations of the transforming DNA molecule63. Often, at least 1 kb of homologous DNA arm is required to achieve homologous recombination efficiencies of about 10%26,64. In contrast, using CRISPR/Cas9 technology, Zhang et al.31 reported an editing accuracy of 95-100 % using very short homologous arms (35 bp) in A. fumigatus. Furthermore, the authors suggest that the microhomology-mediated repair system differs from NHEJ, based on their experiments with the wild-type strain and the knock-out of the ku80 gene (a key gene in the non-homologous end-joining repair system). Since it is the only one report mentioning this hypothesis, we cannot rule out the possibility that, due to the short homologous arms used in this study (~39 bp), the gene cassette may have been inserted at non-specific sites.
Finally, based on the notable improvement of endoglucanase activity obtained in the eglA knock-in edited A. fumigatus mutant, it would be expected that integrating the advantages of biofilm fermentation systems with the use of improved fungal strains could have a significant biotechnology impact, leading to higher yields, productivity and ultimately, profitability. However, future enhancements will focus on optimizing the LMB-35Aa strain by integrating additional genetic modifications to further boost production of enzymes or enzymatic cocktails by genomic design.
Methods
Strains and culture media
Fungal strains A. fumigatus LMB-35Aa12 and A. niger ATCC 10,864 were maintained on potato dextrose agar (PDA) plates at 28 °C. Fungal biomass was obtained by vacuum filtration using a Whatman No. 1 filter paper (Whatman International Ltd, Kent, UK) from potato dextrose broth (PDB) cultures or, alternatively, from cellulase production medium (KH2PO4, 2 g/L; CaCl2.2H2O, 0.3 g/L; MgSO4.7H2O, 0.3 g/L; urea, 0.3 g/L; (NH4)2SO4, 1.4 g/L; peptone, 1 g/L; Tween 80, 2 mL/L; FeSO4.7H2O, 5 mg/L; MnSO4.2H2O, 1.6 mg/L; ZnSO4.7H2O, 1.4 mg/L; CoCl2.6H2O, 2 mg/L)65. The bacterial strain E. coli DH5α was kindly donated by Dr. Richard Garrat (IFSC, USP) and was used for storage and construction of all vectors. The details of the microbial strains used are presented in (Supplementary Table S1).
Biofilm fermentation system (BF)
To obtain the spore inoculum for biofilm formation, A. fumigatus LMB-35Aa strain was grown in PDA for 3 days at 28 °C. After complete sporulation, the spores were resuspended in 10 mL of a 0.1% (v/v) Tween 80 solution and finally adjusted to a concentration of 1 × 105 spores/mL. The formation of biofilms was conducted on polyester supports following the procedure outlined by Gamarra et al. (2010)15, with some modifications. Briefly, a pre-weighted piece of polyester cloth (3.1 cm × 3.1 cm) was placed in 250 mL flasks containing 70 mL of sterile dH2O. Subsequently, flasks were inoculated with 3% (v/v) of the previously prepared spore suspension (inoculum) and incubated at 28 °C and 175 rpm for 30 min to allow spore adhesion to the supports. Then, dH2O was carefully decanted, and the non-adhered spores were removed by washing the cloths twice with the same volume of sterile dH2O for 15 min under the same incubation conditions. Washed cloths were then transferred to new 250 mL flasks containing 70 mL of cellulase production medium using 0.5% carboxymethylcellulose (CMC) as the only carbon source and incubated at the same conditions for 72 h. The cultures were performed in triplicate. Finally, culture supernatants were collected and stored at 4 °C for subsequent analysis of enzyme activity and quantification of soluble protein by using the Pierce™ BCA Protein Assay kit (ThermoFisher), while the fungal biofilms were washed three times with cold sterile dH2O and stored at −80 °C until nucleic acid extraction.
Nucleic acid extraction and cDNA synthesis
Plasmid DNA was extracted using the ZR Plasmid Miniprep kit (Zymo Research) according to the manufacturer’s instructions. Genomic DNA extraction from fungal biomass/biofilms was carried out following the protocol described by Cenis66, with some modifications.
Total RNA extraction from Aspergillus strains was performed from ~ 50 mg of previously pulverized biomass grinded with liquid nitrogen, using the Direct-zol RNA Miniprep kit (Zymo Research) following the manufacturer's instructions.
Nucleic acid samples were eluted in nuclease-free water and stored at −20 °C (DNA) or −80 °C (RNA). Sample concentrations were determined by spectrophotometry using a Nanodrop 2000 (Thermo Scientific) and the integrity of DNA/RNA samples was evaluated by agarose gel electrophoresis.
cDNA synthesis was carried out from 2 μg of total RNA in a final volume of 25 μL using a reverse transcription mix containing 200 U of M-MLV RT enzyme (Promega), 25 U of RNAse inhibitor (RNasin, Promega), 0.5 μM of dNTPs mix, 1X RT buffer, and 1 μg of Oligo(dT)18 as a primer. Reactions were carried out at 42 °C for 60 min and stored at −20 °C until required.
Construction of CRISPR/Cas9 vector and gene cassettes
All PCRs for the construction of the vector and gene cassettes were performed using Phusion DNA Polymerase (Thermo Fisher), according to the manufacturer’s specifications. For gene cassette constructions, DNA fragments were amplified separately and then fused using the fusion PCR technique according to Shevchuk (2004)67. The list of vectors and primers used are presented in Supplementary Table S2 and Table S3, respectively.
To construct the editing vector, the strategy outlined by Nødvig et al. (2015) was closely followed. The similarity of the protospacer sequence to be used (5´CTCAGCGCACGCTCTTCCCG 3´; according to Fuller et al.47) with the pksP gene of A. fumigatus LMB-35Aa strain (Fig. 3) was confirmed. Subsequently, primers encompassing the aforementioned protospacer sequence from the pksP target gene were designed (pksP-gRNA-pFC334-R and pksP-gRNA-FC334-F). Simultaneously, primers that flanked the promoter and terminator regions of the gRNA cassette were designed, containing the BglII and PacI restriction sites (pFC334-BglII-F and pFC334-PacI-R). These primers were employed to amplify two distinct fragments from plasmid pFC334 (Addgene plasmid #87846). Resulting amplicons, both carrying the pksP gRNA protospacer sequence, were annealed and fused by PCR using pFC334-BglII-F and pFC334-PacI-R primers, thus forming the pksP gRNA cassette which was subsequently ligated into the plasmid pFC332 (Addgene plasmid #87845), both previously digested with PacI and BglII. The resulting vector containing the gRNA for knocking out pksP gene, designated as pJB112, was transformed into E. coli DH5α competent cells by heat shock68. Positive clones were verified by colony PCR using the conditions established by the GoTaq enzyme protocol (Promega). For more details of the strategy followed for vector construction, see (Fig. 1).
To construct the integration cassettes encoding the green fluorescent protein (GFP) or the EglA endoglucanase, the following steps were followed: i) for the GFP cassette, on the one hand, the trpC promoter and terminator were amplified from pSilent1 plasmid69 using (pksP1)-PtrpC-F/(gfp)-PtrpC-R and (gfp)-TtrpC-F/(pksP1)-TtrpC-R primers, respectively; on the other hand, reporter gfp gene was amplified from the pERA-4 plasmid70 using (PtrpC)-gfp-F and (TtrpC)-gfp-R primers. Resulting amplicons were annealed and fused by PCR using primers (pksP1)-PtrpC-F and (pksP1)-TtrpC-R, thus forming the GFP cassette; ii) for the eglA cassette, three amplicons corresponding to promoter trpC, eglA gene and trpC terminator were fused. For this purpose, PtrpC and TtrpC were amplified from pSilent1 plasmid69 using (pksP1)-PtrpC-F/(AniEglA)-PtrpC-R and (AniEglA)-TtrpC-F/(pksP1)-TtrpC-R primers, respectively; eglA gene was amplified from A. niger ATCC 10864 cDNA using (PtrpC)-AniEglA-F and (TtrpC)-AniEglA-R primers. Resulting amplicons were annealed and joined by PCR using primers (pksP1)-PtrpC-F and (pksP1)-TtrpC-R, thus forming the eglA cassette. Both replacement gene cassettes contained 39 bp microhomologous arms at the 5ʹ ends of the promoter and 3ʹ ends of the terminator flanking the pksP gene.
Off-target analysis
The chop-chop tool (https://chopchop.cbu.uib.no/) was used for off-target analysis based on the genome of A. fumigatus Af293 strain and, for the LMB-35Aa strain, alignments between the protospacer and PAM sequences against the genome of the LMB-35Aa strain (MCQI00000000.2) were conducted using the BLAST tool (https://blast.ncbi.nlm.nih.gov).
Protoplast formation
For fungal protoplast formation, the procedure outlined by Yelton et al.71 was followed with some modifications. Briefly, 3-day-old spores from A. fumigatus LMB-35Aa strain grown on PDA medium were harvested using 0.1 % (v/v) Tween 80. Then, a suspension of 5 x 108 spores was inoculated into 250 mL flasks containing complete medium (CM: 0.5 % malt extract, 0.5 % yeast extract, and 0.5 % glucose) and incubated at 30 °C and 175 rpm for 14 hours. Young mycelia were recovered in 50 mL tubes by filtration through Mira-Cloth (22–25 µm pore size) and washed with 0.6 M MgSO4·7H2O. Washed fungal biomass (3 g) was transferred to a 250 mL flask containing 25 mL of digestion buffer (1.2 M MgSO4·7H2O in 10 mM sodium phosphate buffer at pH 5.8). Mycelial cell wall was digested using 300 µg of lysing enzyme (Sigma, L1412), for this purpose, the mixture was incubated on ice for 5 min then, BSA was added (3 mg per gram of biomass) and incubated for 4 hours at 30 °C and 100 rpm. Subsequently, formed protoplasts were harvested by filtration through Mira-Cloth into 50 mL tubes and precipitated by the addition of STC buffer (1.2 M sorbitol, 10 mM CaCl2, 10 mM Tris-HCl pH 7.5) in a 1:1 (v/v) ratio and centrifuged at 6000 rpm for 10 min. Finally, protoplasts were resuspended in 1 mL of STC buffer and 1 mL of 40 % PEG 3350 was added for storage at −80 °C until further use.
Polyethylene glycol (PEG)-mediated protoplast transformation
For fungal transformation, the procedure outlined by Yelton et al. (1984)71 was followed with some modifications. Briefly, 1 x 106 fungal protoplasts resuspended in 200 μL of STC buffer were incubated with ~5 µg of the corresponding DNA vector in a 15 mL tube for 20 minutes on ice. Then, 1.25 mL of PEG buffer (PEG 3350 60%, 50 mM CaCl2, 50 mM Tris-HCl pH 7.5) was added and incubated for 20 minutes at room temperature. Subsequently, 5 mL of STC buffer was added and gently homogenized. Transformed protoplasts were centrifuged at 4000 rpm for 10 minutes at 4 °C and resuspended in 1 mL of STC buffer. Finally, protoplasts were plated on Stabilizing Minimal Medium (SMM) following the formulation outlined by Shimizu & Keller (2001)72, with some modifications. It is noteworthy that our medium diverged from Shimizu & Keller´s formulation by the exclusion of MgSO4, adjustment of FeSO4.7H2O and (NH4)6Mo7O24.4H2O to 0.16 and 0.11 g/L, respectively. To solidify the medium, agar was added to a final concentration of 1.6 %. Then, an overlay of 0.9 % agar containing 300 µg/mL hygromycin was added and once solidified, incubated at 30 °C. The appearance of regenerated protoplasts was evaluated at 24, 48, and 72 hours. Finally, transformed colonies were verified in SMM medium containing hygromycin 300 µg/mL. pskP knock-out colonies were verified by their phenotype (albino colonies) and by further PCR and amplicon sequencing using pksP-Seq F and pksP-Seq R primers.
For knock-in gene editing, 2 µg of eglA or gfp gene cassette DNA was added to the transformation reaction. Positives clones were verified by PCR, using primers that flank the Cas9 cut site (pksP-Seq F and pksP-Seq R) for the insertion into the pksP gene locus. Finally, the clone expressing eglA cassette were confirmed by measuring its endoglucanase activity and by gene expression analysis by RT-PCR.
Endoglucanase activity assay
ß-endoglucanase activity was quantitatively determined in 96-well microplates according to the methodology described by Xiao et al. (2005)73 with certain modifications. Briefly, 30 µL of culture supernatant (enzyme) and 60 µL of 1 % CMC (substrate) prepared in 50 mM acetate buffer pH 4.8 were added into each microwell, and incubated for 30 min at 50 °C. The detection and quantification of the reducing sugars produced during CMC hydrolysis were carried out according to Miller´s methodology74 using DNS (3,5-dinitrosalicylic acid) reagent. For this, 90 µL of DNS reagent was added and incubated at 95 °C for 5 min, followed by cooling to 12 °C for 10 min. Finally, 100 µL of the colored mixture was transferred to a 96-well microplate and the absorbance was measured at 540 nm using an EPOCH 2 microplate spectrophotometer (BioTek). An enzyme blank and substrate blank were also included in each assay. The concentration of glucose released by the secreted enzymes was determined by interpolating from a standard curve constructed with known concentrations of glucose. One enzyme unit (U) was defined as the amount of enzyme required to release 1 µmol of reducing sugar equivalents per minute under the defined assay conditions. Specific activity was expressed in enzymatic units per milligram of proteins (U/mg).
Fluorescence and phase-contrast microscopy
To verify gene editing of gfp knock-in strains, a confocal laser scanning microscope (OLYMPUS BX61) equipped with DAPI, WBV, GFP, TRITC, and DICT filters, and a Nikon UPlanSApo VC 40X objective (NA = 0.95) was used. For this purpose, fungal spores were mounted on a glass slide and the GFP protein was excited/monitored at 458/488 nm. Digital images were acquired by using FLUOVIEW FV1200 software (FV10-ASW).
Statistical analysis
For the statistical analysis, Google Colab platform (https://colab.google/) was used. First, the normality of the data distributions for LMB-35Aa and LMB073 was assessed using the Shapiro–Wilk test, which confirmed normality for both groups. Then, Levene’s test was applied to verify the homogeneity of variances. Following these tests, a two-sample t-test (Student’s t-test) was performed.
Data availability
The datasets generated and/or analyzed during the current study are available in the FungiDB (https://fungidb.org/fungidb/app) under the following accession numbers: afu2g17600, M747DRAFT_5215; for the A. fumigatus LMB-35Aa genome, data are available in NCBI (https:// www. ncbi.nlm.nih.gov) under the following accession code: MCQI00000000.2. Mutant sequences are available in GenBank (https://www.ncbi.nlm.nih.gov/genbank/) under the following accession codes: PP910162 (mutant1), PP910163 (mutant2), PP910164 (mutant3) and PP910165 (mutant4). All data generated or analyzed during this study are available in GenBank (https://www.ncbi.nlm.nih.gov/genbank/) and from the corresponding author upon reasonable request.
References
Vu, H. P. et al. A comprehensive review on the framework to valorise lignocellulosic biomass as biorefinery feedstocks. Sci. Total Environ. 743, 140630 (2020).
Bhardwaj, N., Kumar, B., Agrawal, K. & Verma, P. Current perspective on production and applications of microbial cellulases: A review. Bioresour. Bioprocess. https://doi.org/10.1186/s40643-021-00447-6 (2021).
Ranjan, R., Rai, R., Bhatt, S. B. & Dhar, P. Technological road map of Cellulase: A comprehensive outlook to structural, computational, and industrial applications. Biochem. Eng. J. 198, 109020 (2023).
Peterson, R. & Nevalainen, H. Trichoderma reesei RUT-C30—Thirty years of strain improvement. Microbiology 158, 58–68 (2012).
Nazir, M., Iram, A., Cekmecelioglu, D. & Demirci, A. Approaches for producing fungal cellulases through submerged fermentation. Front. Biosci. Elit. 16, 1–13 (2024).
Østby, H., Hansen, L. D., Horn, S. J., Eijsink, V. G. H. & Várnai, A. Enzymatic processing of lignocellulosic biomass: Principles, recent advances and perspectives. J. Ind. Microbiol. Biotechnol. 47, 623–657 (2020).
Filiatrault-Chastel, C., Heiss-Blanquet, S., Margeot, A. & Berrin, J. G. From fungal secretomes to enzymes cocktails: The path forward to bioeconomy. Biotechnol. Adv. 52, 107833 (2021).
Singh, A., Bajar, S., Devi, A. & Pant, D. An overview on the recent developments in fungal cellulase production and their industrial applications. Bioresour. Technol. Rep. 14, 100652 (2021).
Romo Sánchez, S., Gil Sánchez, I., Arévalo-Villena, M. & Briones Pérez, A. Production and immobilization of enzymes by solid-state fermentation of agroindustrial waste. Bioprocess. Biosyst. Eng. 38, 587–593 (2015).
Ma, X., Li, S., Tong, X. & Liu, K. An overview on the current status and future prospects in Aspergillus cellulase production. Environ. Res. 244, 117866 (2024).
Tong, L. et al. Powerful cell wall biomass degradation enzymatic system from saprotrophic Aspergillus fumigatus. Cell Surf. 11, 100126 (2024).
Paul, S. et al. Insights from the genome of a high alkaline cellulase producing Aspergillus fumigatus strain obtained from peruvian amazon rainforest. J. Biotechnol. 251, 53–58 (2017).
Rebaza, T. D., Ludeña, Y., Samolski, I. & Villena, G. K. Gene expression analysis of non-clinical strain of Aspergillus fumigatus (LMB-35AA): Does biofilm affect virulence?. J. Fungi 6, 1–13 (2020).
Gutiérrez, M. & Villena, G. Surface adhesion fermentation: A new fermentation category fermentación por adhesión a superficies: Una nueva categoría fermentativa. Rev. Peru. Biol. 10, 113–124 (2003).
Gamarra, N. N., Villena, G. K. & Gutiérrez-Correa, M. Cellulase production by Aspergillus niger in biofilm, solid-state, and submerged fermentations. Appl. Microbiol. Biotechnol. 87, 545–551 (2010).
El-Ghonemy, D. H., Ali, T. H., El-Bondkly, A. M., Moharam, M. E. S. & Talkhan, F. N. Improvement of Aspergillus oryzae NRRL 3484 by mutagenesis and optimization of culture conditions in solid-state fermentation for the hyper-production of extracellular cellulase. Int. J. Gen. Mol. Microbiol. 106, 853–864 (2014).
Jafari, N., Jafarizadeh-Malmiri, H., Hamzeh-Mivehroud, M. & Adibpour, M. Optimization of UV irradiation mutation conditions for cellulase production by mutant fungal strains of Aspergillus niger through solid state fermentation. Green Process. Synth. 6, 333–340 (2017).
Arumugam Mahadevan, S., Gon Wi, S., Lee, D. S. & Bae, H. J. Site-directed mutagenesis and CBM engineering of Cel5A (Thermotoga maritima). FEMS Microbiol. Lett. 287, 205–211 (2008).
Zheng, F. et al. Enhancing the catalytic activity of a novel GH5 cellulase GtCel5 from Gloeophyllum trabeum CBS 900.73 by site-directed mutagenesis on loop 6. Biotechnol. Biofuels 11, 1–13 (2018).
Lv, K. et al. Enhancing the catalytic activity of a GH5 processive endoglucanase from Bacillus subtilis BS-5 by site-directed mutagenesis. Int. J. Biol. Macromol. 168, 442–452 (2021).
Lambertz, C. et al. Challenges and advances in the heterologous expression of cellulolytic enzymes: A review. Biotechnol. Biofuels 7, 1–15 (2014).
den Haan, R. et al. Heterologous production of cellulose- and starch-degrading hydrolases to expand Saccharomyces cerevisiae substrate utilization: Lessons learnt. Biotechnol. Adv. 53, 107859 (2021).
Meng, Q. S., Liu, C. G., Zhao, X. Q. & Bai, F. W. Engineering Trichoderma reesei Rut-C30 with the overexpression of egl1 at the ace1 locus to relieve repression on cellulase production and to adjust the ratio of cellulolytic enzymes for more efficient hydrolysis of lignocellulosic biomass. J. Biotechnol. 285, 56–63 (2018).
Wang, Y. et al. Constitutive overexpression of cellobiohydrolase 2 in Trichoderma reesei reveals its ability to initiate cellulose degradation. Eng. Microbiol. 3, 100059 (2023).
Krappmann, S., Sasse, C. & Braus, G. H. Gene targeting in Aspergillus fumigatus by homologous recombination is facilitated in a nonhomologous end-joining-deficient genetic background. Eukaryot. Cell 5, 212–215 (2006).
Weld, R. J., Plummer, K. M., Carpenter, M. A. & Ridgway, H. J. Approaches to functional genomics in filamentous fungi. Cell Res. 16, 31–44 (2006).
Adli, M. The CRISPR tool kit for genome editing and beyond. Nat. Commun. https://doi.org/10.1038/s41467-018-04252-2 (2018).
Song, R. et al. CRISPR/Cas9 genome editing technology in filamentous fungi: Progress and perspective. Appl. Microbiol. Biotechnol. 103, 6919–6932 (2019).
Ullah, M., Xia, L., Xie, S. & Sun, S. CRISPR/Cas9-based genome engineering: A new breakthrough in the genetic manipulation of filamentous fungi. Biotechnol. Appl. Biochem. 67, 835–851 (2020).
Nødvig, C. S., Nielsen, J. B., Kogle, M. E. & Mortensen, U. H. A CRISPR-Cas9 system for genetic engineering of filamentous fungi. PLoS ONE 10, 1–18 (2015).
Zhang, C., Meng, X., Wei, X. & Lu, L. Highly efficient CRISPR mutagenesis by microhomology-mediated end joining in Aspergillus fumigatus. Fungal Genet. Biol. 86, 47–57 (2016).
Jin, F. J., Wang, B. T., Wang, Z. D., Jin, L. & Han, P. CRISPR/Cas9-based genome editing and its application in Aspergillus species. J. Fungi 8, 467. https://doi.org/10.3390/jof8050467 (2022).
Nidhi, S. et al. Novel crispr–cas systems: An updated review of the current achievements, applications, and future research perspectives. Int. J. Mol. Sci. 22, 1–42 (2021).
Schuster, M. & Kahmann, R. CRISPR-Cas9 genome editing approaches in filamentous fungi and oomycetes. Fungal Genet. Biol. 130, 43–53 (2019).
Al Abdallah, Q., Ge, W. & Fortwendel, J. R. A simple and universal system for gene manipulation in Aspergillus fumigatus: In vitro-assembled Cas9-guide RNA ribonucleoproteins coupled with microhomology repair templates. mSphere https://doi.org/10.1128/mSphere.00446-17 (2017).
Sasaki, Y., Mitsui, R., Yamada, R. & Ogino, H. Secretory overexpression of the endoglucanase by Saccharomyces cerevisiae via CRISPR-δ-integration and multiple promoter shuffling. Enzyme Microb. Technol. 121, 17–22 (2019).
Minnaar, L. & den Haan, R. Engineering natural isolates of Saccharomyces cerevisiae for consolidated bioprocessing of cellulosic feedstocks. Appl. Microbiol. Biotechnol. 107, 7013–7028 (2023).
Matsu-ura, T., Baek, M., Kwon, J. & Hong, C. Efficient gene editing in Neurospora crassa with CRISPR technology. Fungal Biol. Biotechnol. 2, 1–7 (2015).
Fonseca, L. M., Parreiras, L. S. & Murakami, M. T. Rational engineering of the Trichoderma reesei RUT-C30 strain into an industrially relevant platform for cellulase production. Biotechnol. Biofuels 13, 1–15 (2020).
Manglekar, R. R. & Geng, A. CRISPR-Cas9-mediated seb1 disruption in Talaromyces pinophilus EMU for its enhanced cellulase production. Enzyme Microb. Technol. 140, 109646 (2020).
Wang, Q. et al. CRISPR/Cas9-mediated genome editing in Penicillium oxalicum and Trichoderma reesei using 5S rRNA promoter-driven guide RNAs. Biotechnol. Lett. 43, 495–502 (2021).
Pant, S. et al. Employment of the CRISPR/Cas9 system to improve cellulase production in Trichoderma reesei. Biotechnol. Adv. 60, 108022 (2022).
Singh, V. et al. CRISPR/Cas9 mediated gene editing of transcription factor ACE1 for enhanced cellulase production in thermophilic fungus Rasamsonia emersonii. Fungal Biol. Biotechnol. 10, 1–14 (2023).
Jiang, C. et al. Applications of CRISPR/Cas9 in the synthesis of secondary metabolites in filamentous fungi. Front. Microbiol. 12, 1–15 (2021).
Wang, D., Jin, S., Lu, Q. & Chen, Y. Advances and challenges in CRISPR/Cas-based fungal genome engineering for secondary metabolite production: A review. J. Fungi 9, 362 (2023).
Pham, T. H., Quyen, D. T., Nghiem, N. M. & Vu, T. D. Cloning, expression, purification, and properties of an endoglucanase gene (glycosyl hydrolase family 12) from Aspergillus niger VTCC-F021 in Pichia pastoris. J. Microbiol. Biotechnol. 21, 1012–1020 (2011).
Fuller, K. K., Chen, S., Loros, J. J. & Dunlap, J. C. Development of the CRISPR/Cas9 system for targeted gene disruption in Aspergillus fumigatus. Eukaryot. Cell 14, 1073–1080 (2015).
Lange, L. Fungal enzymes and yeasts for conversion of plant biomass to bioenergy and Ffigh-value products. Fungal Kingd. https://doi.org/10.1128/9781555819583.ch51 (2017).
Dey, P., Rangarajan, V., Singh, J., Nayak, J. & Dilip, K. J. Current perspective on improved fermentative production and purification of fungal cellulases for successful biorefinery applications: A brief review. Biomass Convers. Bioref. 12, 967–995 (2022).
Yang, J. et al. Fungal strain improvement for efficient cellulase production and lignocellulosic biorefinery: Current status and future prospects. Bioresour. Technol. 385, 129449 (2023).
Zhang, J. et al. An efficient CRISPR/Cas9 genome editing system based on a multiple sgRNA processing platform in Trichoderma reesei for strain improvement and enzyme production. Biotechnol. Biofuels Bioprod. 17, 1–18 (2024).
Liu, D., Garrigues, S. & de Vries, R. P. Heterologous protein production in filamentous fungi. Appl. Microbiol. Biotechnol. 107, 5019–5033 (2023).
Sardi, J. D. C. O. et al. Highlights in pathogenic fungal biofilms. Rev. Iberoam. Micol. 31, 22–29 (2014).
Kaur, S. & Singh, S. Biofilm formation by Aspergillus fumigatus. Med. Mycol. 52, 2–9 (2014).
Beauvais, A. & Latgé, J. P. Aspergillus biofilm in vitro and in vivo. Microbiol. Spectr. https://doi.org/10.1128/microbiolspec.MB-0017-2015 (2015).
Gems, D., Johnstone, I. L. & Clutterhuck, A. J. An autonomously replicating plasmid transforms Aspergillus nidulans at (transformation; recombinant DNA; plasmid stability; copy number; inverted repeat). Gene 98, 61–67 (1991).
Ruiz-Díez, B. A review: Strategies for the transformation of filamentous fungi. J. Appl. Microbiol. 92, 189–195 (2002).
Katayama, T. et al. Development of a genome editing technique using the CRISPR/Cas9 system in the industrial filamentous fungus Aspergillus oryzae. Biotechnol. Lett. 38, 637–642 (2016).
Maruyama, J. I. Genome editing technology and its application potentials in the industrial filamentous fungus Aspergillus oryzae. J. Fungi 7, 638 (2021).
Katayama, T. et al. Forced recycling of an AMA1-based genome-editing plasmid allows for efficient multiple gene deletion/integration in the industrial filamentous fungus Aspergillus oryzae. Appl. Environ. Microbiol. https://doi.org/10.1128/AEM.01896-18 (2019).
Nødvig, C. S. et al. Efficient oligo nucleotide mediated CRISPR-Cas9 gene editing in Aspergilli. Fungal Genet. Biol. 115, 78–89 (2018).
Maruyama, J. I., Nakajima, H. & Kitamoto, K. Visualization of nuclei in Aspergillus oryzae with EGFP and analysis of the number of nuclei in each conidium by FACS. Biosci. Biotechnol. Biochem. 65, 1504–1510 (2001).
Esquivel-Naranjo, E. U. & Herrera-Estrella, A. Strong preference for the integration of transforming DNA via homologous recombination in Trichoderma atroviride. Fungal Biol. 124, 854–863 (2020).
Chaveroche, M. K., Ghigo, J. M. & d’Enfert, C. A rapid method for efficient gene replacement in the filamentous fungus Aspergillus nidulans. Nucleic Acids Res. 28, 1–6 (2000).
Duff, S. J. B. Use of surface-immobilized trichoderma in batch and fed-batch fermentations. Biotechnol. Bioeng. 31, 345–348 (1988).
Cenis, J. L. Rapid extraction of fungal DNA for PCR amplification. Nucleic Acids Res. 20, 28080 (1992).
Shevchuk, N. A. et al. Construction of long DNA molecules using long PCR-based fusion of several fragments simultaneously. Nucleic Acids Res. 32, 1–12 (2004).
Sambrook, J. (2001). Plasmid and their usefulness in molecular cloning. Molecular cloning, a laboratory manual, 1, 1-31. Cold Spring Harbor Laboratory.
Nakayashiki, H. et al. RNA silencing as a tool for exploring gene function in ascomycete fungi. Fungal Genet. Biol. 42, 275–283 (2005).
Jensen, E. D. et al. Transcriptional reprogramming in yeast using dCas9 and combinatorial gRNA strategies. Microb. Cell Fact. 16, 1–16 (2017).
Yelton, M. M., Hamer, J. E. & Timberlake, W. E. Transformation of Aspergillus nidulans by using a trpC plasmid. Isotopenpraxis 20, 1470–1474 (1984).
Shimizu, K. & Keller, N. P. Genetic involvement of a cAMP-dependent protein kinase in a G protein signaling pathway regulating morphological and chemical transitions in Aspergillus nidulans. Genetics 157, 591–600 (2001).
Xiao, Z., Storms, R. & Tsang, A. Microplate-based carboxymethylcellulose assay for endoglucanase activity. Anal. Biochem. 342, 176–178 (2005).
Miller, G. L. Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal. Chem. 31, 426–428 (1959).
Acknowledgements
We gratefully acknowledge the funding provided by Consejo Nacional de Ciencia, Tecnología e Innovación Tecnológica de Peru (Grants N° 177-2015-CONCYTEC-FONDECYT-DE), awarded to the Doctoral Program in Biological Sciences and Engineering at the National Agrarian University La Molina. This work was also supported by PROINNOVATE Grant No 144-PROINNOVATE-CETF2-2022 of Ministry of Production of Peru.
Author information
Authors and Affiliations
Contributions
B.P.J.S., S.I. Y.L. and B.P.J.S., S.I. Y.L. and V.G.K. conceived the research experiments, B.P.J.S. conducted the experiments, B.P.J.S., S.I. and V.G.K. analyzed the results. B.P.J.S, S.I and V.G.K wrote the main manuscript. All authors reviewed the manuscript.
Corresponding author
Ethics declarations
Competing interests
The authors declare no competing interests.
Additional information
Publisher's note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Information
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
About this article
Cite this article
Benites-Pariente, J.S., Samolski, I., Ludeña, Y. et al. CRISPR/Cas9 mediated targeted knock-in of eglA gene to improve endoglucanase activity of Aspergillus fumigatus LMB-35Aa. Sci Rep 14, 19661 (2024). https://doi.org/10.1038/s41598-024-70397-4
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41598-024-70397-4
- Springer Nature Limited