Abstract
Individual cell shape and integrity must precisely be orchestrated during morphogenesis. Here, we determine function of type II cadherins, Cdh6, Cdh8, and Cdh11, whose expression combinatorially demarcates the mouse neural plate/tube. While CRISPR/Cas9-based single type II cadherin mutants show no obvious phenotype, Cdh6/8 double knockout (DKO) mice develop intermingled forebrain/midbrain compartments as these two cadherins’ expression opposes at the nascent boundary. Cdh6/8/11 triple, Cdh6/8 or Cdh8/11 DKO mice further cause exencephaly just within the cranial region where mutated cadherins’ expression merges. In the Cdh8/11 DKO midbrain, we observe less-constricted apical actin meshwork, ventrally-directed spreading, and occasional hyperproliferation among dorsal neuroepithelial cells as origins for exencephaly. These results provide rigid evidence that, by conferring distinct adhesive codes to each cell, redundant type II cadherins serve essential and shared roles in compartmentalization and neurulation, both of which proceed under the robust control of the number, positioning, constriction, and fluidity of neuroepithelial cells.
Similar content being viewed by others
Introduction
Morphogenetic processes that elaborate multicellular organisms require rigorous control of individual cell shape, division, gathering, and scattering in each germ layer, which would mainly be coordinated by intimate cell–cell contacts and communications1,2,3,4. For instance, the embryonic dynamics to convert the early monolayer neuroepithelial sheet, neural plate, into the multi-dimensional neural tube termed neurulation is the very initial and essential event to emerge basic cell assembly of the vertebrate central nervous system (CNS). Along the anterior–posterior (A-P) axis of the developing neural plate/tube, several compartment units called neuromeres are formed to prevent cells once patterned from random intermingling5,6,7. As for the dorsal-ventral (D-V) axis of the neural plate/tube, distinct sets of cells are arranged under the gradual action of secretary morphogens such as Wnt, Bmp, and Shh8,9,10,11,12, and the early D-V difference is already crucial to physically role up the neural plate: specific populations of cells at the ventral and/or dorsolateral hinge points (DLHPs) drastically shrink their adherens junction (AJ)-associated apical actin meshwork to bend the initially flat neural plate13,14. In the final process of neurulation, marginal cells in tissue layers should also change their interacting partners: the neural ridge comes to produce mesenchymal neural crest cells emigrating out from the epithelial sheet and simultaneously segregated from the ectodermal layer to form the inner neural tube and the overlaying ectoderm15,16. Importantly, this tissue segregation and/or suturing among neural plate/tube/crest and ectodermal cells at the dorsal midline proceeds like zipper from a few yet distinct and species-specific closure points3,17. Although neurulation defects occur with high frequency in human (~1 in 1000 birth)18,19, underlying cellular and/or molecular mechanisms for neurulation still remain elusive20,21,22,23,24.
Classic cadherins (Cdhs), the core components of cell–cell AJs, are single transmembrane proteins involved in selective cell sorting through specific trans recognitions between their extracellular domains25, while their cytoplasmic domains are linked to the cytoskeletal actin meshwork for rigid and collective cell–cell adhesion26,27. As many as 20 Cdh subclasses have been identified to be grouped into types I and II by their sequence similarity, with most type II Cdh genes clustering in the vertebrate genomes. Recent analyses have revealed that type II Cdh subclasses in the same gene cluster tend to harbor similar binding affinities, conferring diverse and gradable adhesive codes to cells through both homo- and heterophilic interactions in vitro28. Gain of function studies for Cdh subclasses in vivo have accordingly revealed that differential and dynamic Cdh expression switches are crucial in neurulation29,30, compartmentalization31, neural crest emigration32, and precise positioning of spinal motor neurons33 during early development. However, loss of function studies using mouse indicated that, in striking contrast with the early embryonic lethal phenotype for type I Cdh1 (=E-cadherin)-/-34 or Cdh2 (=N-cadherin)-/-35 mice, most type II Cdh single knockout mice and some combinatorial mutants show few embryonic phenotypes despite the considerable levels of early expression31,36,37,38,39. This has often been ascribed to “molecular and/or functional redundancy” of Cdhs, yet no direct evidence for their necessity in early embryogenesis is provided thus far.
In order to further approach the redundant features of type II Cdhs dynamically and abundantly expressed in earlier developmental events, here we selected three type II Cdh subclasses, Cdh6, Cdh8, and Cdh11, from distinct adhesive groups, and systematically generated their combinatorial knockout alleles in mice by taking advantage of CRISPR/Cas9-based methodology40,41. Although we found no obvious phenotype for single type II Cdh knockout (KO) mice in the developing CNS, Cdh6/8 double knockout (DKO) mice developed intermingled forebrain/midbrain compartments as these two type II Cdhs show mutually exclusive expression at the nascent compartment boundary. In addition, Cdh6/8/11 triple KO, Cdh6/8 or Cdh8/11 DKO mice caused exencephaly just within the cranial region where mutated type II Cdh expression merges. In the Cdh8/11 DKO midbrain, we further observed less-constricted apical actin meshwork, ventrally-directed spreading, and occasional hyperproliferation among dorsal neuroepithelial cells as origins toward the exencephalic (EX) phenotype. These results provide the first in vivo evidence that redundant type II Cdhs do confer distinct adhesive codes to each cell to serve essential and shared roles in compartmentalization and neurulation, both of which only proceed under the robust control of the number, positioning, constriction, and fluidity of neuroepithelial cells during early morphogenesis.
Results
Type II Cdhs show distinct genomic organization and arrangement
We first compared genomic organization between types I and II Cdh subclasses by utilizing public genome data bases. We accordingly confirmed that type I Cdh genes contain 16 coding exons, whereas type II Cdh genes only carry 11 coding exons (Supplementary Fig. 1). Remarkably, positions of each exon/intron boundary mapped along Cdh amino-acid sequences were totally conserved among types I and II, respectively (Fig. 1a and Supplementary Fig. 1). For instance, we found that the functionally relevant Cdh cytoplasmic domain interactive with multiple catenin molecules is coded by three exons in type I, whereas only one exon is assigned for this indispensable domain in type II (Fig. 1a and Supplementary Fig. 1). This implicates separable function and constrained evolutionary history among types I and II Cdh genes. We also outlined genomic arrangement of all mouse and human Cdh genes with their binding force and specificity28,42,43, revealing that the clustered organization of type II genes is conserved beyond species (Fig. 1b). Notably, type II Cdh genes with similar binding specificity are clustered in the same chromosome (Fig. 1b). Since structural basis of the most N terminal Cdh extracellular domain is suggested to be an important determinant for the binding specificity42,43, we suspected that accumulation of similar type II Cdh genes in the same chromosomal cluster, possibly by duplication events, may attribute to acquire redundant yet relevant function of type II Cdhs during development and/or evolution. In order to further evaluate the physiological significance of clustered type II Cdh genes in mouse, we selected three type II Cdhs, Cdh6, Cdh8, and Cdh11 in the present study: Cdh6 in the mouse chromosome (chr)15-Cdh gene cluster harbors the highest binding force among type II Cdhs, forming an adhesive group with Cdh9 and Cdh10 in the same gene cluster, while another adhesive group members Cdh8 and Cdh11 are the neighboring genes in the mouse chr8-Cdh cluster with modest binding force (Fig. 1b)28. We accordingly sought to ask if Cdh8/11 with similar binding specificity in the same chromosomal cluster could share redundant function, whereas Cdh6 with different binding specificity in the separate cluster would have some distinct roles than Cdh8/11 during development and/or evolution.
Type II Cdh expression analyses reveal overlapping and dynamic traits in the mouse developing neural plate/tube
We first detailed mRNA expression profiles for these three type II Cdhs in the mouse developing neural plate/tube by means of ISH on serial sections. Consequently, we confirmed the overlapping and dynamic traits of these Cdhs’ expression (Fig. 2 and Supplementary Fig. 2): Cdh6 mRNA expression in the neural plate commenced to demarcate the entire forebrain (Fb) compartment at E8.5 (Fig. 3d, d′) and the Fb-specific expression diminished after development, except for the dorsal midline (Supplementary Fig. 2). Neuroepithelial cells at the midbrain (Mb)/hindbrain boundary and emigrating neural crest cells also strongly expressed Cdh6 (Fig. 2b, g, l, q). Cdh8 mRNA expression was relatively weak before the neural tube closure, but restricted groups of neuroepithelial cells along the A-P and D-V axes came to express Cdh8 (Fig. 2c, h, m, r and Supplementary Fig. 2). As for Cdh11, mesenchymal cells and migrating neural crest cells strongly express this mRNA and some overlapped territory with Cdh8 in the developing neural plate/tube was delineated by Cdh11 mRNA expression (Fig. 2d, i, n, s and Supplementary Fig. 2).
These mRNA expression profiles were partially corroborated by the reporter modified bacterial artificial chromosome (BAC) transgenic (Tg) mouse lines. For example, as we described and confirmed previously44, a BAC clone covering the Cdh6-5′ genomic region (Fig. 3a) carries the specific enhancer demarcating the entire Fb compartment at E8.5 (Fig. 3c–d′). This was further ensured by whole-mount immunostaining results from a Fb marker Pax6 at E8.5 (Fig. 3e–e′). We also found that a BAC clone containing the Cdh8-5′ genomic territory (Fig. 3a and Supplementary Fig. 6) harbors the Mb-specific enhancer at the 22-somite stage (Fig. 3f). If compared with our mRNA expression mapping, those enhancer activities captured by the BAC-reporter-Tg mice were very reminiscent of Cdh8 mRNA expression profiles (Fig. 3g–l). We additionally made sure that three Cdh8-5′ BAC-Tg mouse lines independently generated precisely recapitulate at least a part of Cdh8 mRNA expression profiles in the retina compared with the expression mapping from previously reported LacZ in-frame knock-in mouse45 (Supplementary Fig. 6). Importantly, our BAC-Tg mouse lines never yielded ectopic LacZ expressions in the retina (Supplementary Fig. 6). Noticeably, the Cdh8-Mb-specific enhancer trapped by our BAC-Tg mouse showed a progressive trait correlated with the neural tube closure (Fig. 3m–q). At the early initiation stage, the Cdh8-Mb-specific enhancer activity opposed to the Cdh6-Fb-specific enhancer activity along the nascent Fb/Mb compartment boundary, which was verified by the double staining results with Pax6 and Cdh8::LacZ in the Cdh8-5′ BAC-Tg embryo (Fig. 3n′, r–v).
Further to clarify Cdh8/Cdh11 double-positive territories in the developing neural tube, we generated a Cdh11-EGFPtag knock-in mouse line by means of CRISPR/Cas9-mediated genome editing (Fig. 3a, and Supplementary Fig. 7). We then intercrossed this knock-in mouse line with the Cdh8-5′ BAC-Tg line to reveal the overlapped feature of Cdh8::lacZ and Cdh11-EGFP (Fig. 2u–x). Cdh8 expressing domains along the dorsoventral axis during the Mb development were also ensured by double staining with a dorsal marker Pax7 or a ventral marker FoxA2 in the Cdh8-5′ BAC-Tg embryo to rigorously map Cdh8/Cdh11 double-positive territories in the dorsal Mb during development (painted by bright yellow in Fig. 2x).
Combinatorial gene mutants for type II Cdhs can be generated by genome editing
We then tried to generate multiple gene KO mice for these three type II Cdhs by using the CRISPR/Cas9-based technology41. We designed two single guide (sg) RNAs to completely delete exonic regions encoding the translation start site of each Cdh gene (Fig. 3a, Supplementary Fig. 3a, and Supplementary Table 1). By injecting these six sgRNAs and Cas9 expression vectors into the pronuclei of fertilized mouse eggs at the same time, we successfully obtained viable and fertile triple hetero mice for three Cdh loci. Genomic sequences verified at the targeted regions and the top 10 off-target regions for each sgRNA revealed that only expected deletions occur in the genome (Supplementary Fig. 3a and Supplementary Fig. 4). Other unwanted changes, if any, in the genome were not assessed in the present study, yet we considered that those under top 10 mutations outside of the linkage with Cdh loci could never be retained over multiple crossing and selection of the line.
We next generated mice deficient for each Cdh locus by intercrossing to show that these mice are virtually viable and fertile with no fatal phenotype, which is in line with previous series of reports31,36,37,38,39. Using western blotting in tissues derived from these single KO mice, we also confirmed that manipulated alleles for the three type II Cdh genes are all protein null (Fig. 3b). By further mating the Cdh6/8/11 triple hetero mice, we finally generated mice with combinatorial type II Cdh deletions. It should be noted first that some populations among F0 or F1 Cdh6/8/11 triple hetero mice were found to carry Cdh8/11 cis mutations in the same gene cluster after the multiple outer or intercrossing. For instance, our mating results no. 5 and no. 7 in the Supplementary Fig. 5a indicated the possibility that their mother and/or father may contain Cdh8/11 cis mutations. In addition, we could rarely obtain live triple KO organisms and found that the total number of various Cdh double KO (DKO) after birth was much smaller than expected (Supplementary Fig. 5a). This indicates that triple KO mice for Cdh6/8/11 are embryonic lethal, and some DKO mice would also have abnormalities in the embryonic stages. We therefore examined embryonic phenotypes after various type II Cdh deletions in the CNS.
Fb/Mb compartment boundary is excessively disrupted only in Cdh6/8 DKO
One remarkable phenotype was detected in Cdh6/8 DKO embryos by E10.5 after immunostaining the cranial regions with a transcription factor and the Fb marker Pax6 (Fig. 4e). At this stage, Pax6 expression sharply delineates the Fb/Mb boundary in the wild type (WT; Fig. 4a, b) and we have previously shown that this expression boundary can be defined as the compartment boundary from the 5-somite stage by means of direct neuroepithelial cell labeling and lineage tracing in the mouse whole embryo culture46. In Cdh6 KO, Cdh8 KO, Cdh6 KO; Cdh8+/−, Cdh6+/−; Cdh8 KO, Cdh8/11 DKO or Cdh6+/−; Cdh8/11 DKO embryos, the Pax6 expression boundary was still sharp and straight like that in WT because entire neuroepithelial cells express Cdh2 to hold the differential adhesive code between the Fb and Mb without Fb-specific Cdh6 or Mb-specific Cdh8 expression (Fig. 4c, d, g, and Supplementary Fig. 8, 9). However, in Cdh6/8 DKO embryos, where opposing Cdh deletions at both sides of the compartment boundary totally equalize the neuroepithelial cell affinity (Fig. 4g), the Pax6 expression limit turned to be fuzzy and intermingled with 100% penetrance (Fig. 4e–g, and Supplementary Fig. 8, 9). By systematically measuring the total boundary length in each genotype (Supplementary Fig. 10, 11), we revealed that only Cdh6/8 DKO embryos doubled the total length of Pax6 expression boundary (Fig. 4f). Since our measuring method could not reach Pax6-negative cell clusters within the Pax6-positive territories, which are only prominent in Cdh6/8 DKO embryos (Supplementary Fig. 11m), actual total length of Pax6 expression boundary in Cdh6/8 DKO might be underestimated. These results indicate that the mutually exclusive expression profiles of Cdh6 and Cdh8 at the Fb/Mb compartment boundary (Figs. 3v, 4g) are indeed necessary for compartmentalization by conferring selective adhesiveness to cells in each compartment unit.
Multiple type II Cdh deletions cause defect in the cranial neural tube closure
Another obvious defect in the neural tube closure called exencephaly was found in the embryonic cranial region when more than three alleles out of the six type II Cdh alleles were deleted (Fig. 5a, b). We noticed that the patterns of exencephaly at E12.5 coincide with three type II Cdh expression profiles at the closing dorsal Mb (Fig. 5a and Supplementary Fig. 2). For instance, in the Cdh6/8 DKO Mb, only the caudal region where Cdh6 and Cdh8 expression overlapped in the closing neural tube showed exencephaly. In the Cdh8/11 DKO Mb, the entire region failed to fuse at the dorsal midline as the expression of both type II Cdh genes merged throughout the Mb. In Cdh6/8/11 triple KO, regions beyond the Mb showed defects in the neural tube closure (Fig. 5a and Supplementary Fig. 2). Notably, the more we deleted type II Cdh genes, the higher was the penetrance of exencephaly (Fig. 5b). In addition, we found that the EX phenotype appears regardless of the mouse strain background after the crossing for six generations (Supplementary Fig. 5b, c). These results collectively demonstrated that redundant yet differential type II Cdh expression profiles could specify positional and/or progressive cues for the neural tube closure.
To address the cellular machinery that causes exencephaly, we further detailed the tissue organization and proliferative states in the Cdh8/11 DKO Mb at E9.5. In the frontal sections, we revealed that the apical actin fibers visualized by phalloidin staining became discontinuous even in the non-EX Cdh8/11 DKO Mb (Fig. 5c–i). We also examined patterns of F-actin localization over the en face views of the cranial neural plate/tube ventricular zone to confirm that the apical actin meshwork associated with Cdh-based AJs is less constricted in the non-EX Cdh8/11 DKO dorsal Mb, but shows no difference between WT and Cdh8/11 DKO in the dorsal Fb (Fig. 6a–d). Noticeably, those cells with less-constricted actin meshwork tended to cluster in the non-EX Cdh8/11 DKO Mb (Fig. 6e), well explaining the discontinuous phalloidin staining in the frontal sections (Fig. 5c–i). In addition, the results from a dividing cell marker phosphorylated histone H3 staining indicated that cell proliferation increases only in the dorsal half of non-EX Cdh8/11 DKO Mb with Pax7 expression (Fig. 5j–r). Important is the fact that the area showing hyperproliferation in the Cdh8/11 DKO Mb is totally correlated with the Cdh8/11 mRNA double-positive territory in the closing neural tube (Colored by bright yellow in Fig. 2x). Taken together, it is implicated that redundant type II Cdh expression exquisitely balances apical constriction as well as proliferative states of neuroepithelial cells to coordinate the neural plate bending and/or eventual neural tube closure (Fig. 6f).
Exencephaly upon Cdh deletion is not primarily due to gene expression changes, but mainly be initiated by increased cell fluidity and division in neuroepithelia
We next investigated the gene expression changes after type II Cdh gene mutations in the developing Fb and Mb by means of RNA-sequencing to outline that only a limited number of genes change their expression in the Mb exhibiting exencephaly (Fig. 7 and Supplementary Fig. 12). Among them, Fgf15 was one of the seven Mb-specific fluctuated genes over exencephaly (Fig. 7) and has been known by proliferative function at the developing dorsal midbrain47. Consistently, the fine evaluation by ISH revealed an apparent increase in Fgf15 mRNA in the open Mb of the E9.5 Cdh8/11 DKO embryo (Fig. 7d–i and Supplementary Fig. 13a, d, e). As the dorsal midline in WT as well as non-EX Cdh8/11 DKO is completely negative for Fgf15 (Fig. 7h and Supplementary Fig. 13d) and the neural ridge in the exencephaly continuously expressed Fgf15 (Fig. 7j and Supplementary Fig. 13e), the dorsal midline closure in the normal situation could be the stop signal to suppress Fgf15 expression, whereby cell proliferation rate is reduced to maintain the cytoarchitecture (see “Discussion”).
We additionally mapped several gene expression patterns using ISH in the Cdh8/11 DKO Mb and realized that dorsal cells expressing Wnt1, Wnt3a, and Cdh6 tend to spread ventrally in the mutant neural tube (Fig. 8a–k). The neuroepithelial cells with the dorsal identities seemed to shift to the ventral domain asymmetrically in the Cdh8/11 DKO Mb: the shift pattern was totally different between the right and left side of the neural plate (Fig. 8c–j). This indicates that the ventral shift does not occur by the coordinated neural tube patterning mechanisms but does procced in a stochastic manner. We thus concluded that those neuroepithelial cells express both Cdh8 and Cdh11 lost their original adhesive code at the dorsal Mb, increasing the fluidity along the D-V axis (Figs. 2x, 8c–j). This fluid trend was also detected with Pax7 expressing cells in the Cdh8/11 DKO Mb (Supplementary Fig. 13). Importantly, the ventral most Shh expression domain showed little change at the initial neurulation stages in the Cdh8/11 DKO Mb (Fig. 8i, j), indicating that enhancement of neuroepithelial cell fluidity is confined within the Cdh8/11 double-positive dorsal domain, which is very consistent with the dorsal-dominant occurrence of excess cell proliferation (Fig. 5j–r). However, within 24 h, the ventral domain with Shh expression became narrower in the Cdh8/11 DKO Mb (Supplementary Fig. 14a–c, j). We thus concluded that the redundant Cdh8/11 expression profile in the developing midbrain is primarily required to maintain the neuroepithelial cell constriction, proliferation and fluidity at a proper level. Without Cdh8/11 expression, the neural tube bending dynamics could be affected to prevent the neural ridge fusion, thus resulting in continuous activation of proliferative pathways such as Fgf15 signaling. This may make the situation worse to secondarily develop the EX phenotypes in the mutant.
Discussion
In the present study, we successfully generate combinatorial type II Cdh mutant mice by taking advantage of CRSIPR/Cas9-based genome editing methodology. Consequently, we reveal that, if two or more type II Cdh genes are mutated, fluidity of neuroepithelial cells is apparently enhanced both along the A-P and D-V axes only within those territories covered with these two or more Cdh expression. This virtually leads to random cell intermingling at the forebrain/midbrain compartment boundary as well as Cdh expression-overlapped area dependent defects in neural tube closure called exencephaly in the double mutants. To our knowledge, this is the first study to systematically evaluate the redundant and/or dose-dependent traits of Cdh function to maintain the robustness of cytoarchitecture during early vertebrate embryogenesis.
In the context of compartmentalization, roles of mutually exclusive Cdh expression patterns at the boundary have been suggested for a long time, but no experimental treatments can disrupt the rigid boundary cell integrity in vivo2,31. Our present data now underscore the significance of Cdh expression profiles in specifying the neuroepithelial cell affinity and fluidity along the A-P axis. As Cdh6 and Cdh8 genes locate at different gene clusters to share distinct cell adhesiveness (Fig. 1b), selective cell sorting machinery under the control of opposed enhancer activities (Fig. 3v) would play significant role to maintain the compartment boundary. Noticeably, cell intermingling at the Fb/Mb compartment boundary in Cdh6/8 DKO was more remarkable in the dorsal portion within the Pax6 expressing territory (Fig. 4e and Supplementary Figs. 9–11). This is in line with the results that opposed Cdh6/8 enhancer activities only occurs at the dorsal portion of the compartment boundary (Fig. 3v). As we have previously determined by fate mapping of the mouse prosencephalic neural plate, Fb/Mb compartment boundary is established at around the 5-somite stage46. This stage just fits to the timing of enhancer activation for Cdh6 as well as Cdh8 genes (Fig. 3c, m, n), facilitating deeper understanding of the Cdh6/8 DKO phenotype in the Fb/Mb compartmentalization.
Incidentally, redundant traits of Cdh expression in brain compartmentalization have also been highlighted in our present study: we could detect few cell cluster formation at around the Fb/Mb compartment boundary in Cdh6 KO, Cdh8 KO, Cdh6 KO; Cdh8+/−, Cdh6+/−; Cdh8 KO, Cdh8/11 DKO or Cdh6+/−; Cdh8/11 DKO embryos (Fig. 4 and Supplementary Figs. 9–11). These phenotypes can be partly explained by the observation that a type I Cdh Cdh2 (=N-cadherin) protein expression is maintained throughout the Fb and Mb upon any type II Cdh gene deletions (Supplementary Fig. 8). For instance, without Cdh8, redundant Cdh2 expressing Mb cells can still be sorted out from Cdh2 + Cdh6 expressing Fb cells (Fig. 4g). The data from in vitro measuring of the binding force (Fig. 1b) also support that Cdh2 by itself can confer enough selective adhesiveness to the Mb cells in Cdh8 KO mice and vice versa in Cdh6 KO mice. In this context, notable is the tendency that loss of Cdh6 with the strongest binding force appears to give a non-significant yet sporadically recognizable impact on the Fb/Mb compartmentalization (Fig. 4f). As was the case with rhombomere segmentation48,49,50, some other molecules such as Eph/ephrins signaling might help minimize the Cdh single KO phenotypes along this compartment boundary.
Given the differential expression of multiple Cdhs at other neuromere boundaries31,51, selective cell adhesion-mediated machinery could ensure the robustness of these compartment boundaries in the same way. Identification of integrative upstream transcription factors and/or signaling molecules elaborating the opposing Cdh expression at the boundary, possibly by utilizing our BAC-Tg mice (Fig. 3a, c, c′, n, n′, r–v), might be one of the critical points to elucidate compartmentalization machinery during development and/or evolution.
In the process of neural tube closure, involvement of molecular cascades including the planer cell polarity (PCP) pathway has been implicated because most mice with pathway molecule knockouts show the EX phenotype3. As for the cellular machinery, D-V biased contraction of F-actin meshwork patterned by the PCP pathway in the neuroepithelial sheet explains the bending kinetics of the neural plate3,14. Coordinated neural tube bending at the DLHP is also suggested to be under the control of PCP pathway21. Our present results raise the new possibility that controlled cell positioning and division established by redundant expression of Cdhs determines D-V arrangement of the neural plate/tube: Multiple type II Cdh gene deletions would weaken AJ stability and biased actin contractility, ameliorating cellular fluidity and proliferation rate in the neuroepithelial sheet to prevent neural plate/tube bending and closure (Figs. 6f, 8k). Mechanistically, cells with less amount of type II Cdhs would have less capacity for actin meshwork contractility (Fig. 6b–f), could drift ventrally as clusters from the original position, and might disrupt the critical population of cells like those at the DLHP to prevent neural plate bending (Fig. 8k). Increased proliferation among those cells would enhance the probability of disrupting the DLHP, finally attributing to the EX phenotype (Figs. 5j–r, 6f, 8k). Progressive Cdh8 enhancer activities during neural tube closure (Fig. 3m–q) might also help define the closure point to process the zippering along the cranial dorsal midline, which could be correlated with the Fgf15 signaling (Fig. 7d–i).
Interestingly, we found Fgf15 downregulation at the dorsal midline of the non-EX Cdh8/11 DKO Mb (Fig. 7i), suggesting a two-step model to progress exencephaly in our mutant. Before the Mb neural tube closure, the first step proceeds at the confined Cdh8/11 double-positive territory, where the loss of these two Cdhs enhances neuroepithelial cell fluidity to disrupt coordinated bending of the neural tube and/or to occasionally increase mitotic index. After the failure of neural tube closure, the subsequent step occurs at the neural ridge, where excess cell proliferation is caused by sustained Fgf15 signaling. Shh-expressing domain was only narrowed at the later developmental stages in the EX Cdh8/11 DKO Mb (Supplementary Fig. 14a–c, j), well supporting the two-step model where ventrally mislocalized Wnts and/or enhanced Fgf15-expressing cells in the open neural tube later affect the Shh-expressing ventral most domain in the mutant Mb (Supplementary Fig. 14d–i)
Noticeable is the finding that patterns of exencephaly are generated in a manner almost parallel with merged expression profiles of type II Cdhs at the dorsal aspect of the cranial neural tube (Fig. 5a and Supplementary Fig. 2), which is totally different from EX phenotypes previously reported under PCP gene knockout analyses3,52,53. This may imply that expression patterns of Cdhs primarily determine rigid positional cues for the neural tube closure to completely read the PCP signaling inputs.
Overall, our study highlights that nested expression profiles of type II Cdhs are virtually required in common for compartmentalization and neurulation, both of which at a glance stand as entirely different morphogenetic events, yet only proceed under the rigorous control of the number, arrangement, constriction, and fluidity of neuroepithelial cells along the A-P and D-V axes. Incidentally, at the later neurodevelopmental stages, Cdhs can localize at the interneuronal synaptic peri-active zone called the puncta adherentia54,55, and combinatorial yet redundant expression of type II Cdhs along the neuronal circuitry have been also shown to play indispensable roles in the distinct connectivity for the retina45,56 and hippocampus57. As physiological redundancy of Cdhs could greatly contribute to validating the robustness of naturally selected cytoarchitecture during development and/or evolution, the value of the clustered organization for Cdh genes and their functional relevance determined here or by others21,51 must thoroughly be dissected across species. For example, an immediate research target would be evaluating how the in-line configuration of type II Cdh genes contributes to the overlapped (or mutually exclusive) mRNA expression by shared (or competitive) enhancers in the cluster. As those events that break all active Cdh genes in the cluster must rarely be happening during development and/or evolution, it might simultaneously be important to determine to what extent the clustered arrangement of type II Cdh genes safeguard the cytoarchitectonic robustness in respective animal species with distinct tissue/organ complexity. This will eventually clarify the principle of phylogenetic diversity and/or pathogenetic risks (i.e., metastatic cancers, neuropsychiatric diseases and so on) in stably elaborating and/or maintaining a variety of multicellular organizations under the regulation of cell–cell integrity and communication.
Methods
Animal experiments
All experimental procedures were approved by the National Institute of Neuroscience Institutional Animal Care and Use Committee and were performed in accordance with the guidelines. B6C3F1, C3H, and ICR mouse strains were obtained from Japan SLC. The day on which the vaginal plug was detected was designated as the embryonic day (E) 0.5 and the precise developmental stage of embryos was decided according to Theiler58.
ISH for mRNA
Antisense RNA probes labeled with digoxigenin (Dig)-11-UTP (Roche) were prepared from pBSII11.0B (Cdh6), pCRII-8 (Cdh8), pSP73-11 (Cdh11), pGEMT (Fgf15), pBSII (Wnt1), and pBSII-SK (Wnt3a and Shh), all of which contain each cDNA fragment. For the antisense probe, EcoRI (Cdh6 and Cdh11), SpeI (Cdh8), NotI (Fgf15), and HindIII (Wnt1, Wnt3a, and Shh) linearized vectors were transcribed with T3 (Cdh6, Wnt1, Wnt3a, and Shh) or T7 (Cdh8, Cdh11 and Fgf15) RNA polymerase (T3: Roche, T7: Invitrogen) in vitro. All probes prepared were purified by Quick Spin Columns Sephadex G-50 (Roche), and stored in 50% formamide solutions at −80˚C. Cryosections with 14-μm thickness were prepared from mouse embryos fixed overnight with 4% paraformaldehyde in phosphate-buffered saline (pH 7.4; 4% paraformaldehyde/phosphate-buffered saline; PFA/PBS) at 4 ˚C and collected on glass slides (CRE-01, Matsunami). Pretreatment, hybridization and probe detection processes were performed under the ordinary protocol59. Photographs were taken under a microscope-imaging system (KEYENCE, #BZ-X700).
Generation of Cdh6/8/11 knockout mouse alleles
Six single guide (sg) RNAs (6A, 6B, 8A, 8B, 11A, and 11B) shown in Fig. 3a, Supplementary Fig. 2a and Supplementary Table 1 were designed within the ATG containing exons of Cdh6, Cdh8, and Cdh11, respectively, to delete 70–109 bp genomic fragment for the frameshift mutations. This eventually made the genotyping processes easier by means of simple PCR without sequencing (Supplementary Fig. 3). The human codon-optimized SpCas9 and sgRNA expressing plasmid, pX33060, was obtained from Addgene (Plasmid #42230) and the annealed oligos (20 bp) was ligated into the BbsI site for the sgRNA expressions. Six pX330-sgRNA plasmid DNA were purified by using HiPure Plasmid Midiprep kit (invitrogen) and directly injected into pronuclei of B6C3F1 fertilized eggs at the same time with the concentrations of 2 ng/μl each (12 ng/μl in total)61. In total, 18 pups developed from 235 injected eggs were screened by PCR with three pairs of primers shown in Fig. 3a and Supplementary Table 2. Among them, one carried all the expected deletions for Cdh6, Cdh8, and Cdh11 validated by sequencing analyses (Supplementary Fig. 3). By crossing a wild-type (WT) mouse (B6C3F1) with the founder, all the knockout alleles were transmitted to a F1 progeny. The top 10 off-target candidate loci for the six sgRNAs were predicted by CRISPR DESIGN (crispr.mit.edu) and amplified by PCR with primers listed in Supplementary Table 2 and the genomic DNA extracted from the F1 progeny. Those PCR products were then analyzed by sequencing to confirm that only expected deletions occur in the genome. All the knockout alleles used in this study were derived from this on and off-target sequence-verified Cdh6/8/11 triple hetero mouse. To examine the effect of mouse strain background on the EX phenotype, ICR and C3H mice (Japan SLC) were additionally crossed to the triple hetero knockout mouse. The EX rate was analyzed after the fifth generation of crossing.
Generation of the Cdh6-5' and Cdh8-5′ BAC-Tg mice
The Cdh6-5′ BAC (RP24-88H4) and Cdh8-5′ BAC (RP24-284F19) shown in Fig. 3a were purchased from BAC PAC Resources (CHORI) and modified by random insertion of a Tn1000 transposon containing β-globin minimal promoter and β-galactosidase (LacZ) gene cassette in bacterial cells62. The transposon insertion sites in each BAC clone were determined by sequencing and modified BAC-Tg lines were generated as described previously44. Multiple independent Tg lines were generated for each BAC clone, and the LacZ expression patterns were confirmed among them.
Generation of Cdh11-EGFP knock-in allele by CRISPR/Cas9-mediated genome editing
Cdh11-crRNA (5′-GUCAUCAUCAAAAGUGUCUUguuuuagagcuaugcuguuuug-3′) and tracrRNA (5′- AAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU-3′) were chemically synthesized by FASMAC (Kanagawa, Japan). Recombinant Cas9 protein (EnGen Cas9 NLS) were purchased from NEB. The long single-strand DNA (long ssDNA) donor containing EGFP sequence flanked by 345 nucleotides (nt) left homology arm and 410 nt right homology arm was synthesized by using Guide-it Long ssDNA Strandase Kit (Takara Bio). The guide RNAs, Cas9 proteins, and the donor ssDNA were microinjected into B6C3F1 mouse zygotes. An obtained knock-in founder was confirmed to carry the correct EGFP-fused allele by PCR and sequencing analyses, and the subsequent generations were used in this study.
Western blotting analyses
Total proteins were extracted from the WT or Cdh6/8/11 single mutant mouse cerebral cortex at the postnatal day seven and separated by 10% polyacrylamide gel electrophoresis. Proteins were transferred to PVDF membrane (Millipore IPVH00010) with AE-6687 HorizeBLOT system (ATTO). Primary antibodies and dilutions used were rabbit anti-Cdh6 (ab133632, abcam); 1:200, mouse anti-Cdh8 (CAD8-1, DSHB); 1:1000, goat anti-OB-cadherin (Cdh11) (sc-6463, SANTA CRUZ); 1:200, and mouse anti-β-actin (ab6276, abcam); 1:2000. Secondary antibodies utilized were anti-rabbit IgG, horseradish peroxidase (HRP)-linked (GE Healthcare NA9340V) diluted 1:5000, HRP-linked anti-mouse IgG (Jackson Immuno Research) diluted 1:5000, and Donkey anti-goat IgG-HRP (SANTA CRUZ) diluted 1:5000. Signal bands were detected by using ECL Prime Western Blotting Detection Regent (GE Healthcare RPN2232) and images were captured on LAS-4000 Luminescent Image Analyzer (Fujifilm).
Detection of LacZ activities
Embryos were harvested from BAC-Tg mouse lines described above. Detection of LacZ activities was performed in whole-mount samples as reported44. In brief, embryos were fixed on ice with PBS (pH 7.4) containing 1% PFA, 0.1% glutaraldehyde, 2 mM MgCl2, 5 mM EGTA, and 0.02% Igepal CA-630 (Sigma) for 20 min. After several washings by PBS containing 0.02% Igepal CA-630, samples were put in the staining solution containing 5 mM K3Fe(CN)6, 5 mM K4Fe(CN)6·3H2O, 2 mM MgCl2, 0.01% sodium deoxycholate, 0.02% Igepal CA-630 and 0.1% X-gal (Wako, Japan) at 37 ˚C for 2 h. Subsequently, samples were thoroughly washed in PBS containing 0.02% Igepal CA-630, post-fixed with PBS containing 5 mM ethylenediaminetetraacetic acid (EDTA), 1% paraformaldehyde, 0.1% glutaraldehyde and 0.02% Igepal CA-630 at 4 ˚C and stored in PBS containing 1 mM EDTA at 4 ˚C. Whole-mount images were taken under the binocular microscope (MZ FLIII, Leica) equipped with a CCD camera (ProgRes C3, Jenoptik). For sectioning, embryos equilibrated by 30% sucrose were embedded in TissueTek compound and 14-μm cryosections were collected on glass slides (CRE-01, Matsunami). After counter-staining with Neutral Red (Wako, Japan), slides were serially immersed into 25%, 50%, 75%, and 100% ethanol, dipped twice into 100% xylene, air-dried and finally mounted by HSR solution (Kokusai-Shiyaku, Japan). Images were captured under a microscope-imaging system (KEYENCE, #BZ-X700).
F-actin staining
Cryosections
Embryos were fixed with 4% PFA/PBS at 4˚C for 2 h and washed with PBS containing 0.05% Triton-X-100 (0.05% PBST). For sectioning, they were immersed in a graded series of sucrose solutions and embedded in TissueTek OCT compound (Sakura Finetek). Cryosections with 14 µm thickness were prepared and transferred to glass slides (CRE-01, Matsunami). After the sections were treated with PBS to remove the OCT compound, they were treated with 1% normal donkey serum (NDS) in 0.05% Triton/PBS (blocking buffer) at room temperature for 1 h and incubated with 0.05% Triton/PBS containing 1 drop/ml ActinRed 555 ReadyProbes (Life technologies) at room temperature for 30 min. Specimens were subsequently rinsed with 0.05% Triton/PBS and 4′,6-diamidino-2-phenylindole (DAPI) (1:10,000; Invitrogen) staining was performed to visualize nuclei. After mounting with PermaFluor Aqueous Mounting Medium (Thermo), fluorescent images were acquired under BZ-X700 (KEYENCE).
En face preparation
Embryos were fixed overnight with 4% PFA/PBS at 4 ˚C. Next day, cranial regions were sagittally cut into halves along the midline and re-fixed overnight with 4% PFA/PBS at 4 ˚C. After fixed samples were washed three times by 0.05% Triton/PBS, they were incubated with PBS containing 1 drop/ml ActinRed 555 ReadyProbes (Life technologies) at room temperature for 30 min. After removing the staining solution, samples were washed with 0.05% Triton/PBS three times. Glass slides were processed to place a mounting area for the cranial samples by covering both ends of a slide with a piece of 2–3 cm long scotch tape. Processed slides were then mounted with PermaFluor Aqueous Mounting Medium (Thermo) to acquire the fluorescent images under BZ-X700 (KEYENCE).
Evaluation of Cdh8::LacZ and Cdh11-EGFP co-expressions by immunohistochemistry
Anti-Pax6 (rabbit; Medical & Biological Laboratories #PD022), Pax7 (mouse; DSHB, PAX7-s), FoxA2 (mouse; DSHB, 4C7), β-galactosidase (β-gal: chicken; abcam, ab9361) and GFP (rabbit; MBL, 598) were used as the primary antibody at dilution of 1:1000 (Pax6), 1:10 (Pax7), 1:20 (FoxA2), 1:1000 (β-gal) and 1:1000 (GFP), respectively. For the secondary antibody, Alexa Fluor 488 donkey anti-chicken IgG (Jackson Immuno Research, 703-545-155), 647 donkey anti-mouse IgG (abcam, ab150111) and 647 donkey anti-rabbit IgG (abcam, ab150075) were utilized at dilution of 1:600. Immunostaining was performed according to the standard methods. DAPI (1:10000; Invitrogen) staining was performed to visualize nuclei. Fluorescent images were acquired under BZ-X700 (KEYENCE).
Evaluation of proliferative rates by immunohistochemistry
Anti-phosphorylated histone H3 (p-H3) (rat; sigma, #9908, rabbit; cell signaling, 9701S) and Pax7 (mouse; DSHB, PAX7-s) were used as the primary antibody at dilution of 1:400 (p-H3) and 1:10 (Pax7). For the secondary antibody, Alexa Fluor 488 donkey anti-rat IgG (Invitrogen, A-21208), 488 donkey anti-rabbit IgG (Invitrogen, A-32790), 647 donkey anti-mouse IgG (abcam, ab150111) were utilized at dilution of 1:600. Immunostaining was performed according to the standard methods. DAPI (1:10000; Invitrogen) staining was performed to visualize nuclei. Fluorescent images were acquired under BZ-X700 (KEYENCE). For quantification, ImageJ was used to measure the length of neural fold and divided the neural fold into two parts (Dorsal part or Ventral part) in p-H3 and DAPI-stained embryo sections. p-H3 and DAPI foci were manually counted in each part.
Evaluation of Cdh2 protein distribution by immunohistochemistry
Immunostaining was performed according to the standard methods. In brief, embryos were dissected and fixed overnight with 4% PFA/PBS at 4 ˚C. After the fixation, embryos were heated in 10 mM sodium citrate buffer pH6.0 at 80 ˚C for 30 min by a block incubator (ASTEC: BI-525A, sample holder: TM-15). After cooling on ice, samples were incubated for the blocking with 10% NDS in 0.1% PBST at room temperature for 1 h. Anti-Pax6 (rabbit; Medical & Biological Laboratories #PD022) and Cdh2 (rat; DSHB, MNCD2) were used as the primary antibody at dilution of 1:1000 (Pax6) and 1:10 (Cdh2). For the secondary antibody, Alexa Fluor 488 donkey anti-rat IgG (Invitrogen, A-21208), 647 donkey anti-rabbit IgG (abcam, ab150075) were utilized at dilution of 1:600. DAPI (1:10000; Invitrogen) staining was performed to visualize nuclei. Fluorescent images were acquired under BZ-X700 (KEYENCE).
Whole-mount immunostaining using DAB
Whole-mount immunostaining was performed as described63. In brief, embryos were dissected and fixed overnight with 4% PFA/PBS at 4 ˚C. Next day, embryos were sagittally cut into halves along the midline and fixed overnight with 4% PFA/PBS at 4˚C. After the fixation, embryos were heated in 10 mM sodium citrate buffer pH6.0 at 80 ˚C for 30 min by a block incubator (ASTEC: BI-525A, sample holder: TM-15). After cooling on ice, samples were immersed in methanol containing 5% hydrogen peroxide at room temperature for 3.5 h to bleach and/or inactivate endogenous peroxidase. The brains were rehydrated with PBS containing 0.5% Triton-X (PBST) and incubated for the blocking with 2% skim milk and 1% DMSO in PBST (PBSTMD) at room temperature for 1 h. After subsequent incubation with 1:250 diluted primary antibodies (anti-Pax6 rabbit; Medical & Biological Laboratories #PD022) for 3 days and 1:300 diluted HRP-conjugated secondary antibodies (donkey anti-rabbit IgG; GE healthcare #NA934VS) for 2 days at 4 ˚C with intervening 3 h washings, the samples were stained by the reaction with 1 mg/ml of diaminobenzidine (DAB) in PBST. The stained samples were finally photographed by a Leica MZ FLIII fluorescence stereomicroscope equipped with a CCD camera (ProgRes C3, Jenoptik).
Whole-mount immunostaining using fluorescent probes
Embryos were dissected and fixed overnight with 4% PFA/PBS at 4 ˚C. Next day, embryos were sagittally cut into halves along the midline and fixed overnight with 4% PFA/PBS at 4 ˚C. After the fixation, embryos were heated in 10 mM sodium citrate buffer pH6.0 at 80 ˚C for 30 min by a block incubator (ASTEC: BI-525A, sample holder: TM-15). After cooling on ice, samples were washed 0.1% PBST and incubated for the blocking with 10% NDS in 0.1% PBST at 4˚C for overnight. After subsequent incubation with primary antibodies (1:250, anti-Pax6 rabbit; Medical & Biological Laboratories #PD022, 1:10, anti-Pax7 mouse; DSHB, PAX7-s) for three days and 1:300 diluted secondary antibodies (Alexa Fluor 488 donkey anti-rabbit IgG; abcam, ab150075, 647 donkey anti-mouse IgG; abcam, ab150111) for 2 days at 4 ˚C with intervening 3 h washings, fluorescent images were acquired under BZ-X700 (KEYENCE).
Image quantification
Measurement for the total length of boundaries
To measure the length of embryonic boundaries, Pax6-stained en face images were processed by Photoshop Ver. 6.0 and ImageJ ver. 1.51s. How to measure the length of Pax6 expression boundary and the net length of dorsal Fb/Mb boundary at E10.5 was detailed in Supplementary Fig. 10 and 11. In brief, the net length of dorsal Fb/Mb boundary (L in Supplementary Fig. 10 and 11) was defined as the shortest line from the ventral most point of Pax6 expression territory towards the dorsal midline. Length of the Pax6 expression boundary was measured after the auto contrast processing by Photoshop and perimeter of Pax6-positive cell clusters was separately calculated after re-processing with the auto contrast tool. The total length of Pax6 expression boundaries was then divided by net length of dorsal Fb/Mb boundary for quantification and graphed. It should be noted that Pax6 is a transcription factor and the staining signal mainly localize within the cell nuclei. Thus, the delineated Pax6 expression boundary with this method became a little bit curved or zigzag line and always longer than the net length of dorsal Fb/Mb boundary which is defined by a straight line.
Apical surface area
Maximum intensity projections in the apical region of phalloidin-stained en face images were acquired under BZ-X700 (KEYENCE). The “Tissue Cell Geometry Stats” plugin (with manual correction) in ImageJ was used to outline individual cells and measure their apical area.
Definition of relative positions in the neural plate/tube (RPN) occupancy of mRNA
As shown in Fig. 7b, the length of the ventricular surface from the tip of the neural fold to the ventral hinge point (=L) was equally divided into eight portions (=L/8) on the ISH section images. By setting tangential lines at the divided points and drawing vertical lines to the tangents towards the mantle zone, the neural fold is partitioned into eight areas (1~8) (=relative positions in the neural plate/tube: RPN). Mean occupancy of mRNA-positive cells across each RPN was measured by ImageJ and graphed along the eight areas.
Measurement of Shh-expressing area
Areas for Shh-expressing domain or entire neural tube were traced by hand using a tool in ImageJ ver. 1.51s. Measured amount of Shh-positive area was then divided by that of the entire neural tube and graphed.
Sample preparation for RNA-sequencing
WT male/females or Cdh6/8/11 triple hetero mouse male/females were mated to obtain WT, Cdh DKO and triple KO (TKO) embryos, respectively. Among the non-EX Cdh8/11 DKO embryos, those with elongated midbrain were defined as the “cranial defect (CD)” group and those displayed EX phenotypes were characterized as the “Ex” group. Only embryos at E9.5 (24 ± 2 somite stage) were dissected to collect the forebrain and midbrain tissue separately in a 1.5 ml tube (ST-0150F: BIO-BIK). The tube was immediately frozen in Liq N2 and stored at −80 ˚C. Their genotypes were confirmed by PCR for yolk sac samples, post hoc. After all, collected tissue samples were classified into four groups, namely, WT, DKO_CD, DKO_Ex, and TKO_Ex, and processed for RNA-sequencing.
RNA-sequencing and data analysis
Total RNA was extracted using RNeasy Plus Universal Kit (Qiagen). Quality and quantity measurements of extracted RNA were performed using NanoDrop (Thermo Fisher Scientific) and Qubit Fluorometer (Thermo Fisher Scientific), respectively. Sequencing libraries were prepared using the NEBNext Ultra Directional RNA Library Prep Kit for directional libraries (New England BioLabs) and the KAPA HTP Library Preparation Kits (KAPA Biosystems) according to the manufacturer’s instructions. The RNA-seq libraries were each sequenced (101 cycles) using the Illumina HiSeq platforms.
Raw sequence reads were aligned to the reference mouse genomes (GRCm38/mm10) by TopHat264 (parameters: –mate-inner-dist 400, –mate-std-dev 400, –library-type fr-firststrand, –read-realign-edit-dist 0). Genome-wide expression levels were measured as a unit of fragments per kilobase of exon per million fragments mapped using Cufflinks65 and the numbers of reads were counted per gene per sample using htseq-count within HTSeq66. Finally, differentially expressed genes were identified by DESeq267.
Statistics and reproducibility
All the values were the means ± standard deviation of at least three independent experiments. Statistical analyses were performed using student’s t test. Differences were considered to be significant at P < 0.05. Reproducibility of mRNA ISH and immunostaining data was always ensured by at least three independent rounds of procedures for three or more serial sections from each sample.
Reporting summary
Further information on research design is available in the Nature Research Reporting Summary linked to this article.
Data availability
RNA-seq data sets that support our findings have been deposited in the international public repository, Gene Expression Omnibus (GEO) with the accession code #GSE157008. Source Data are available in Supplementary Data 1. All other relevant data are available from the authors upon request.
References
Townes, P. L. & Holtfreter, J. Directed movements and selective adhesion of embryonic amphibian cells. J. Exp. Zool. 128, 53–120 (1955).
Fagotto, F. The cellular basis of tissue separation. Development 141, 3303–3318 (2014).
Nikolopoulou, E., Galea, G. L., Rolo, A., Greene, N. D. & Copp, A. J. Neural tube closure: cellular, molecular and biomechanical mechanisms. Development 144, 552–566 (2017).
Toda, S., Blauch, L. R., Tang, S. K. Y., Morsut, L. & Lim, W. A. Programming self-organizing multicellular structures with synthetic cell-cell signaling. Science 361, 156–162 (2018).
Fraser, S., Keynes, R. & Lumsden, A. Segmentation in the chick embryo hindbrain is defined by cell lineage restrictions. Nature 344, 431–435 (1990).
Figdor, M. C. & Stern, C. D. Segmental organization of embryonic diencephalon. Nature 363, 630–634 (1993).
Lumsden, A. & Krumlauf, R. Patterning the vertebrate neuroaxis. Science 274, 1109–1115 (1996).
Parr, B. A., Shea, M. J., Vassileva, G. & McMahon, A. P. Mouse Wnt genes exhibit discrete domains of expression in the early embryonic CNS and limb buds. Development 119, 247–261 (1993).
Ikeya, M., Lee, S. M., Johnson, J. E., McMahon, A. P. & Takada, S. Wnt signalling required for expansion of neural crest and CNS progenitors. Nature 389, 966–970 (1997).
Liem, K. F. Jr., Tremml, G. & Jessell, T. M. A role for the roof plate and its resident TGFbeta-related proteins in neuronal patterning in the dorsal spinal cord. Cell 91, 127–138 (1997).
Jessell, T. M. Neuronal specification in the spinal cord: inductive signals and transcriptional codes. Nat. Rev. Genet. 1, 20–29 (2000).
Dessaud, E., McMahon, A. P. & Briscoe, J. Pattern formation in the vertebrate neural tube: a sonic hedgehog morphogen-regulated transcriptional network. Development 135, 2489–2503 (2008).
Hildebrand, J. D. & Soriano, P. Shroom, a PDZ domain-containing actin-binding protein, is required for neural tube morphogenesis in mice. Cell 99, 485–497 (1999).
Nishimura, T., Honda, H. & Takeichi, M. Planar cell polarity links axes of spatial dynamics in neural-tube closure. Cell 149, 1084–1097 (2012).
Morriss-Kay, G. & Tan, S. S. Mapping cranial neural crest cell migration pathways in mammalian embryos. Trends Genet. 3, 257–261 (1987).
Copp, A. J., Greene, N. D. E. & Murdoch, J. N. The genetic basis of mammalian neurulation. Nat. Rev. Genet. 4, 784–793 (2003).
Copp, A. J. & Greene, N. D. Genetics and development of neural tube defects. J. Pathol. 220, 217–230 (2010).
Copp, A. J. & Greene, N. D. Neural tube defects–disorders of neurulation and related embryonic processes. Wiley Interdiscip. Rev. Dev. Biol. 2, 213–227 (2013).
Wallingford, J. B., Niswander, L. A., Shaw, G. M. & Finnell, R. H. The continuing challenge of understanding, preventing, and treating neural tube defects. Science 339, 1222002 (2013).
Pyrgaki, C., Trainor, P., Hadjantonakis, A. K. & Niswander, L. Dynamic imaging of mammalian neural tube closure. Dev. Biol. 344, 941–947 (2010).
Massarwa, R. & Niswander, L. In toto live imaging of mouse morphogenesis and new insights into neural tube closure. Development 140, 226–236 (2013).
Nonomura, K. et al. Local apoptosis modulates early mammalian brain development through the elimination of morphogen-producing cells. Dev. Cell 27, 621–634 (2013).
Hashimoto, H., Robin, F. B., Sherrard, K. M. & Munro, E. M. Sequential contraction and exchange of apical junctions drives zippering and neural tube closure in a simple chordate. Dev. Cell 32, 241–255 (2015).
Galea, G. L. et al. Biomechanical coupling facilitates spinal neural tube closure in mouse embryos. Proc. Natl Acad. Sci. USA 114, E5177–E5186 (2017).
Nose, A., Tsuji, K. & Takeichi, M. Localization of specificity determining sites in cadherin cell adhesion molecules. Cell 61, 147–155 (1990).
Hirano, S., Nose, A., Hatta, K., Kawakami, A. & Takeichi, M. Calcium-dependent cell-cell adhesion molecules (cadherins): subclass specificities and possible involvement of actin bundles. J. Cell Biol. 105, 2501–2510 (1987).
Nagafuchi, A. & Takeichi, M. Cell binding function of E-cadherin is regulated by the cytoplasmic domain. Embo. J. 7, 3679–3684 (1988).
Brasch, J. et al. Homophilic and heterophilic interactions of type II cadherins identify specificity groups underlying cell-adhesive behavior. Cell Rep. 23, 1840–1852 (2018).
Detrick, R. J., Dickey, D. & Kintner, C. R. The effects of N-cadherin misexpression on morphogenesis in Xenopus embryos. Neuron 4, 493–506 (1990).
Fujimori, T., Miyatani, S. & Takeichi, M. Ectopic expression of N-cadherin perturbs histogenesis in Xenopus embryos. Development 110, 97–104 (1990).
Inoue, T. et al. Role of cadherin in maintaining the compartment boundary between the cortex and striatum during development. Development 128, 561–569 (2001).
Nakagawa, S. & Takeichi, M. Neural crest emigration from the neural tube depends on regulated cadherin expression. Development 125, 2963–2971 (1998).
Price, S. R., De Marco Garcia, N. V., Ranscht, B. & Jessell, T. M. Regulation of motor neuron pool sorting by differential expression of type II cadherins. Cell 109, 205–216 (2002).
Riethmacher, D., Brinkmann, V. & Birchmeier, C. A targeted mutation in the mouse E-cadherin gene results in defective preimplantation development. Proc. Natl Acad. Sci. USA 92, 855–859 (1995).
Radice, G. L. et al. Developmental defects in mouse embryos lacking N-cadherin. Dev. Biol. 81, 64–78 (1997).
Horikawa, K., Radice, G., Takeichi, M. & Chisaka, O. Adhesive subdivisions intrinsic to the epithelial somites. Dev. Biol. 215, 182–189 (1999).
Mah, S. P., Saueressig, H., Goulding, M., Kintner, C. & Dressler, G. R. Kidney development in cadherin-6 mutants: delayed mesenchyme-to-epithelial conversion and loss of nephrons. Dev. Biol. 223, 38–53 (2000).
Suzuki, S. C. et al. Cadherin-8 is required for the first relay synapses to receive functional inputs from primary sensory afferents for cold sensation. J. Neurosci. 27, 3466–3476 (2007).
Dewitz, C., Duan, X. & Zampieri, N. Organization of motor pools depends on the combined function of N-cadherin and type II cadherins. Development 146, dev.180422 (2019).
Jinek, M. et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816–821 (2012).
Wang, H. et al. One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell 153, 910–918 (2013).
Katsamba, P. et al. Linking molecular affinity and cellular specificity in cadherin-mediated adhesion. Proc. Natl Acad. Sci. USA 106, 11594–11599 (2009).
Vendome, J. et al. Structural and energetic determinants of adhesive binding specificity in type I cadherins. Proc. Natl Acad. Sci. USA 111, 4175–4184 (2014).
Inoue, T. et al. Analysis of mouse Cdh6 gene regulation by transgenesis of modified bacterial artificial chromosomes. Dev. Biol. 315, 506–520 (2008).
Duan, X., Krishnaswamy, A., Huerta, I. & Sanes, J. Type II cadherins guide assembly of a direction-selective retinal circuit. Cell 158, 793–807 (2014).
Inoue, T., Nakamura, S. & Osumi, N. Fate mapping of the mouse prosencephalic neural plate. Dev. Biol. 219, 373–383 (2000).
Ishibashi, M. & McMahon, A. P. A sonic hedgehog-dependent signaling relay regulates growth of diencephalic and mesencephalic primordia in the early mouse embryo. Development 129, 4807–4819 (2002).
Lumsden, A. Closing in on rhombomere boundaries. Nat. Cell Biol. 1, E83–E85 (1999).
Mellitzer, G., Xu, Q. & Wilkinson, D. G. Eph receptors and ephrins restrict cell intermingling and communication. Nature 400, 77–81 (1999).
Xu, Q., Mellitzer, G., Robinson, V. & Wilkinson, D. G. In vivo cell sorting in complementary segmental domains mediated by Eph receptors and ephrins. Nature 399, 267–271 (1999).
Redies, C. & Takeichi, M. Cadherins in the developing central nervous system: an adhesive code for segmental and functional subdivisions. Dev. Biol. 180, 413–423 (1996).
Hamblet, N. S. et al. Dishevelled 2 is essential for cardiac outflow tract development, somite segmentation and neural tube closure. Development 129, 5827–5838 (2002).
Wang, Y., Guo, N. & Nathans, J. The role of frizzled3 and frizzled6 in neural tube closure and in the planar polarity of inner-ear sensory hair cells. J. Neurosci. 26, 2147–2156 (2006).
Fannon, A. M. et al. Novel E-cadherin-mediated adhesion in peripheral nerve: schwann cell architecture is stabilized by autotypic adherens junctions. J. Cell Biol. 129, 189–202 (1995).
Uchida, N., Honjo, Y., Johnson, K. R., Wheelock, M. J. & Takeichi, M. The catenin/cadherin adhesion system is localized in synaptic junctions bordering transmitter release zones. J. Cell Biol. 135, 767–779 (1996).
Duan, X. et al. Cadherin combinations recruit dendrites of distinct retinal neurons to a shared interneuronal scaffold. Neuron 99, 1145–1154 (2018).
Basu, R. et al. Heterophilic type II cadherins are required for high-magnitude synaptic potentiation in the hippocampus. Neuron 96, 160–176 (2017).
Theiler, K. The House Mouse. Development and normal stages from fertilization to 4 weeks of age. (Springer, New York, 1972).
Inoue, T., Tanaka, T., Suzuki, S. C. & Takeichi, M. Cadherin-6 in the developing mouse brain: expression along restricted connection systems and synaptic localization suggest a potential role in neuronal circuitry. Dev. Dyn. 211, 338–351 (1998).
Cong, L. et al. Multiplex genome engineering using CRISPR/Cas system. Science 339, 819–823 (2013).
Mashiko, D. et al. Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA. Sci. Rep. 3, 3355 (2013).
Morgan, B. A. et al. Transposon tools for recombinant DNA manipulation: characterization of transcriptional regulators from yeast, Xenopus, and mouse. Proc. Natl Acad. Sci. USA 93, 2801–2806 (1996).
Inoue, T., Chisaka, O., Matsunami, H. & Takeichi, M. Cadherin-6 expression transiently delineates specific rhombomeres, other neural tube subdivisions, and neural crest subpopulations in mouse embryos. Dev. Biol. 183, 183–194 (1997).
Kim, D. et al. TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 14, R36 (2013).
Trapnell, C. et al. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 28, 511–515 (2010).
Anders, S., Pyl, P. T. & Huber, W. HTSeq–a Python framework to work with high-throughput sequencing data. Bioinformatics 31, 166–169 (2015).
Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550 (2014).
Acknowledgements
We thank Dr. Masatoshi Takeichi for discussions and anti-mouse Cdh2 antibody, Dr. Suzanne L. Mansour for the pGEMT (Fgf15) plasmid, and the sequence core of Dr. Ichizo Nishino’s laboratory in NCNP for the extensive off-target analyses. We also acknowledge funding supports from KAKENHI (24300130, 16H06524, 16H06528, 16H06531, 17H05967, and 19H04922), AMED (17ek0109285, 17ek0109239, and 20ek0109490h001), and Intramural Research Grant for Neurological and Psychiatric Disorders of NCNP (27-7 and 30-9). We further appreciate fruitful discussions with Drs. Toshihiko Ogura and Atsushi Kubo under the support of Cooperative Research Project Program of Joint Usage/Research Center at the Institute of Development, Aging and Cancer, Tohoku University.
Author information
Authors and Affiliations
Contributions
T.I. conceived and designed experiments with K.H., and Y.U.I. Ma.H. together with J.A., and Y.M. performed off-target analysis. RNA-seq and analysis was performed by S.T. and Y.G. Under the supervision of T.I., all other experiments and analysis of those experiments were carried out by K.H. with assistance and advice from Y.U.I., J.A., Y.M., and Mi.H. T.I. wrote the manuscript under the help with K.H., Y.U.I., and Y.G.
Corresponding author
Ethics declarations
Competing interests
The authors declare no competing interests.
Additional information
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Hiraga, K., Inoue, Y.U., Asami, J. et al. Redundant type II cadherins define neuroepithelial cell states for cytoarchitectonic robustness. Commun Biol 3, 574 (2020). https://doi.org/10.1038/s42003-020-01297-2
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s42003-020-01297-2
- Springer Nature Limited
This article is cited by
-
Spatiotemporal transcriptomic maps of whole mouse embryos at the onset of organogenesis
Nature Genetics (2023)
-
Distinctive chaperonopathy in skeletal muscle associated with the dominant variant in DNAJB4
Acta Neuropathologica (2023)