Abstract
Background
The sperm flagellum is an evolutionarily conserved specialized organelle responsible for sperm motility and male fertility. Deleterious mutations in genes involved in the sperm flagellum assembly can often cause sperm motility defects and male infertility. The murine Dnali1 gene encodes a protein that is known to interact with the cytoplasmic dynein heavy chain 1.
Results
A Dnali1-mutated mouse model was generated by inducing a nonsense mutation in the Dnali1 gene. The Dnali1-mutated male mice presented impaired sperm motility and were completely infertile. Although no obviously abnormal sperm morphology was observed in Dnali1-mutated male mice, the ultrastructural structure of sperm flagellum was disrupted, displaying as an asymmetrical distribution of the longitudinal columns (LCs). Notably, infertile Dnali1-mutated male mice were able to obtain offspring via ICSI.
Conclusions
Our results uncover a role of DNALI1 in sperm motility and male fertility in mice, and demonstrate that ICSI overcomes Dnali1-associated male infertility, thus providing guidance for the diagnosis and genetic counseling of DNALI1-associated human infertility.
Résumé
Contexte
Le flagelle des spermatozoïdes est un organite spécialisé conservé au cours de l’évolution, responsable de la mobilité des spermatozoïdes et de la fertilité mâle. Les mutations délétères des gènes impliqués dans l’assemblage du flagelle des spermatozoïdes peuvent souvent causer des défauts de mobilité des spermatozoïdes et une infertilité mâle. Le gène murin Dnali1 code pour une protéine flagellaire connue pour interagir avec la chaîne lourde 1 de la dynéine cytoplasmique.
Résultats
Un modèle murin muté au niveau de Dnali1 a été généré par induction d’une mutation non-sens dans le gène Dnali1. Les souris mâles mutées au niveau de Dnali1 présentaient une altération de la mobilité des spermatozoïdes et étaient complètement infertiles. Bien qu’aucune morphologie manifestement anormale des spermatozoïdes n’ait été observée chez les souris mâles mutées au niveau de Dnali1, l’ultrastructure du flagelle des spermatozoïdes est perturbée, se présentant avec une distribution asymétrique des colonnes longitudinales. En particulier, les souris mâles infertiles mutées au niveau de Dnali1 ont pu obtenir une progéniture au moyen de l’injection intracytoplasmique de spermatozoïdes.
Conclusions
Nos résultats révèlent un rôle de DNALI1 dans la mobilité des spermatozoïdes et dans la fertilité mâle chez la souris; ils montrent que l’ICSI surmonte l’infertilité mâle associée à Dnali1, fournissant ainsi des conseils pour le diagnostic et le conseil génétique de l’infertilité masculine associée à DNALI1.
Mots-clés
Infertilité; Mobilité des Spermatozoïdes; Asthénozoospermie; Flagelle des Spermatozoïdes; ICSI.
Similar content being viewed by others
Introduction
The sperm flagellum is an axoneme-based structure which is essential for sperm motility [1]. As the core structure of sperm flagellum, the axoneme consists of highly ordered “9 + 2” microtubules characterized by a central microtubule pair connected to nine peripheral outer microtubule doublets (MTDs) [2, 3]. Radial spokes that link peripheral doublets to the central microtubule pair, nexin-dynein regulatory complexes that connect each peripheral doublet, and dynein arms that are multiprotein ATPase complexes, are also essential components for the axoneme [4, 5]. Among them, dynein arms, including the inner and the outer dynein arm (IDA and ODA) within the axoneme, provide the motor apparatus for the movement of the sperm flagellum through ATP hydrolysis, and are indispensable for flagellar beating [6, 7].
Peri-axonemal structures surrounding the axoneme, such as outer dense fibers (ODFs), mitochondrial sheath (MS), and fibrous sheaths (FSs), are required for structural cohesion, energy regulation, or cell signaling [1, 8, 9]. According to the location of peri-axonemal structures on the sperm flagellum, the sperm flagellum can be subdivided into four segments: connecting piece, midpiece, principal piece, and end piece [10]. The MS is located on the midpiece, and the FS is located on the principal piece; while the ODF surrounds the axoneme in both the midpiece and principal piece [1]. However, the distribution and structure of ODFs differ between the midpiece and principal piece of sperm flagella. In the midpiece, ODFs contain nine fibers, each of which is associated with a microtubule doublet; while in the principal piece, the third and eighth ODFs are replaced by two longitudinal columns (LCs) of the FS, with corresponding diminished fibers ending at the annulus [11].
The murine dynein axonemal light intermediate chain 1 (Dnali1) gene is localized on chromosome 4 and consists of six exons. It is enriched in spermatocytes, spermatids, and sperm flagella, indicating a potential function in spermatogenesis [12]. The orthologue gene in Tetrahymena thermophila is known as p28, and a previous study revealed a role of p28 in ciliary motility [13]. Recently, two studies reported that mutations in DNALI1 gene is associated with human infertility [14, 15]. In mice, two Dnali1 knockout mouse lines were reported recently, including one line with a large deletion (6307 bp) covering exons 3–5 of murine Dnali1 [15], and the other line with a conditional knockout of Dnali1 in male germ cells [16]. Both lines displayed disrupted sperm motility and abnormal flagellum ultrastructure. Here, by generating and analyzing a mouse model carrying a nonsense mutation in exon 5 of the murine Dnali1 gene, we clarify the functions of DNALI1 in sperm motility and sperm flagellum assembly, and provides experimental evidence that the assisted reproduction by ICSI overcomes Dnali1-associated male infertility.
Materials and methods
Generation of Dnali1-mutated mouse model
A nonsense mutation was induced in the exon 5 of murine Dnali1 gene (i.e. conversion of a “CAG” codon to a “TAG” STOP-codon) using zygotic base-editing-mediated iSTOP-technology [17]. Briefly, the single-guide RNA (sgRNA) was specifically designed against the exon 5 of murine Dnali1 (target: TGAACAGAAGGCGAAATGCG). sgRNA and CBE mRNA used for zygotic injection were in vitro transcribed according to the instructions as previously reported [17]. Injected zygotes were cultured to the two-cell embryo stage, followed by embryo transfer into foster female mice (8 weeks old, ICR) to obtain founder mice. Female founder mice were crossed with WT C57BL/6 mice to establish the mutant mouse line. The nonsense mutation (“TAG” STOP-codon) in Dnali1 was verified in founder mice and their offspring through PCR and Sanger sequencing. All animal experiments were carried out in accordance with the recommendations of the US National Institutes of Health’s Guide for the Care and Use of Laboratory Animals, and the ethical guidelines of Fudan University. The primers used are presented in Table S1.
Real-time quantitative PCR and reverse transcription PCR
Total RNA of mouse testes was extracted using the AllPrep DNA/RNA/Protein Mini Kits (80004, QIAGEN) or Trizol reagent (15596018, Invitrogen), and converted into cDNAs by a Hiscript III 1st Stand cDNA Synthesis Kit (R312-02, Vazyme). The obtained cDNAs were individually diluted tenfold to be used as templates for the subsequent real-time quantitative PCR with ChamQ SYBR qPCR Master Mix (Q311-03, Vazyme). Gapdh was used as an internal control. The expression of mRNA was quantified according to the 2−ΔΔCt method.
Immunoblotting analysis
The proteins of mouse tissues were extracted using RIPA (P0013B, Beyotime) or AllPrep DNA/RNA/Protein Mini Kits (80004, QIAGEN), then denatured at 95 ℃ for 10 min. The denatured proteins were separated on 10% SDS–polyacrylamide gels and transferred to a polyvinylidene difluoride (PVDF) membrane (IPVH00010, Millipore) for the immunoblotting analysis. After a blocking step in 5% milk diluted with TBST (TBS-0.1% Tween 20) for 1 h, the membranes were incubated overnight at 4 ℃ using the anti-DNALI1 (1:750, 17601–1-AP, Proteintech, or 1:1000, ab155490, Abcam), anti-GAPDH (1:3000; abs132004, Absin) or anti-α-TUBULIN (1:1500; PTM-5442, PTM BIO) antibodies diluted in blocking buffer. Then the membranes were washed in TBST and incubated with HRP conjugated secondary antibody (1:2500; SA00001-2, Proteintech) diluted in blocking solution for 1 h at room temperature. After washing three times in TBST, blots were revealed using the ECL reagents (WBKLS0100, Sigma-Aldrich) and a chemiluminescent imaging system (4600, Tanon).
Analyses of sperm morphology, sperm motility and flagellar ultrastructure
Hematoxylin and eosin (H&E) staining was conducted to assess sperm morphology. For sperm count and sperm motility analysis, the fresh sperm samples of WT and Dnali1−/− adult male mice were released from the cauda epididymis into 1 mL of HTF capacitation solution (MR-070-D, Millipore), and incubated at 37 ℃ for 15 min. Sperm characteristics of mice were evaluated using the computer-assisted sperm analysis system. Transmission electron microscopy (TEM) assays were performed on sperm to analyze flagellar ultrastructure. For TEM, the prepared sperm were washed and immersed in 2.5% phosphate buffered glutaraldehyde, washed three times with 0.1 mol/L phosphate buffer (PB, pH = 7.2), and post fixed with 1% osmium tetroxide in 0.1 mol/L PB at 4 ℃ for 1–1.5 h. Dehydration was conducted using graded ethanol (50%, 70%, 90%, and 100%) and 100% acetone, followed by infiltration with 1:1 acetone and SPI-Chem resin overnight at 37 ℃. After infiltration and embedding in Epon 812, the specimens were sliced with ultra-microtome and stained with uranyl acetate and lead citrate. The samples were observed and photographed via a TEM (TECNAI-10, Philips) with an accelerating voltage of 80 kV.
Histological analysis of tissues
Fresh tissues were obtained from WT and Dnali1−/− adult male mice, fixed in Bouin’s solution (HT10132, Sigma-Aldrich) or 4% PFA, embedded in paraffin, and sectioned to a 5-μm thickness. After deparaffinization and rehydration, sections were stained with hematoxylin–eosin (G1120, Solarbio Science & Technology) or Periodic acid-Schiff (PAS) (G1281, Solarbio Science & Technology).
Immunofluorescence (IF)
For IF, cryosections of mouse testes were rinsed in PBS, permeabilized with 0.5% Triton X-100, and treated with 10% goat serum (AR1009, Boster Biological Technology). Then the slides were incubated overnight at 4 °C with anti-DNALI1 (1:150; 17601–1-AP, Proteintech) antibody. After washing three times with PBS, the slides were incubated with Alexa Fluor 568 conjugated secondary antibody (1:1000; A11036, Thermo Fisher) for 1h, and counterstained with Hoechst 33342 (1:1000; H1399, Thermo Fisher) at room temperature for 10 min. Fluorescence images were collected using a laser scanning confocal microscope (Nikon A1, Nikon). Sperm were washed in PBS, fixed in 4% PFA for 30 min at room temperature, and coated on adhesion microscope slides (80312–3161-16, CITOGLAS). Then the slides of sperm smears were washed in 1 mL of PBS and blocked in 10% donkey serum before being incubated overnight at 4 ℃ with the following primary antibodies: rabbit polyclonal anti-DNAH2 (1:100; HPA067103, Sigma-Aldrich), anti-DNAH17 (1:100; a gift from Professor Qinghua Shi to Dr. Chunyu Liu), monoclonal mouse anti-α-TUBULIN (1:500; T9026, Sigma-Aldrich). Washes were performed using PBS with 0.1% (v/v) Tween-20, followed by incubation at room temperature for 1 h with secondary antibodies Alexa Fluor 488 anti-Mouse IgG (1:1000; A32766, Invitrogen) and Cy3-conjugated AffiniPure Goat anti-Rabbit IgG (1:4000; 111–165-003, Jackson). Images were captured with a confocal microscope (LSM 880, Zeiss).
Intracytoplasmic sperm injection (ICSI)
B6D2F1 (C57BL/6 × DBA2) female mice (8 to 10 weeks old) were superovulated as previously described [18]. In brief, the female mice were superovulated by injecting 7.5 IU of pregnant mare serum gonadotropin, followed by 7.5 IU of human chorionic gonadotropin 48h later. For ICSI, oocytes were obtained from superovulated female mice, and sperm heads were injected into oocytes as previously described [19,20,21]. The reconstructed embryos were cultured in KSOM medium (MR-107-D, Millipore) at 37 ℃ under 5% CO2 to the two-cell stage, and then were transferred into the oviducts of pseudopregnant foster female mice (8 weeks old, ICR) at 0.5 day postcoitum.
Statistics
At least three biological replicates were used for all data presented with statistical analyses. Evaluation of statistical significance between two groups was performed with unpaired Student’s t-tests. P values are defined as follows: * P < 0.05; ** P < 0.01; ***P < 0.001; not significant (ns) as P > 0.05.
Results
Absence of the evolutionarily conserved DNALI1 protein leads to male infertility in mice
To investigate the physiological functions of Dnali1, we first examined its expression levels across various tissues obtained from WT mice, and found that Dnali1 expression was highly enriched in the testis (Fig. 1A). Further Dnali1 transcript level in WT mouse testes from different postnatal days was determined. During postnatal spermatogenesis, Dnali1 expression was initiated at approximately postnatal day 15 (P15); and then the expression of Dnali1 increased and remained elevated from postnatal day 18 (P18) (Fig. 1B). An interspecies protein sequence alignment indicated that DNALI1 is highly conserved in mammals (Fig. 1C).
To characterize the function of Dnali1 in spermatogenesis, we further constructed Dnali1-mutated mice. Sanger sequencing of the PCR-amplicon from the targeted region confirmed the presence of a nonsense mutation in Dnali1-mutated mice, which causes premature translational termination of the DNALI1 protein (Fig. 1D). Real-time quantitative PCR (qPCR) assays (with primers listed in Table S1) verified a dramatically reduced mRNA expression of Dnali1 in the testes from Dnali1 homozygous mutated (Dnali1−/−) male mice compared to the WT control (Fig. S1). Immunoblotting assay showed an absence of DNALI1 protein in tissues of Dnali1−/− male mice (Fig. 1E and Fig. S2). To explore the effect of the Dnali1 deficiency on fertility, WT and Dnali1−/− male mice (10 weeks of age) were mated with adult WT females, and the numbers of pups per litter were counted. We found that Dnali1−/− male mice failed to produce any offspring after mating with WT adult female mice during a three-month observation window (Fig. 1F).
Dnali1 deficiency causes damaged sperm motility
Hydrocephalus is observed in some Dnali1−/− mice (Fig. S3-S4). We further analyzed the phenotypic changes (related to male infertility) in testes and sperm of Dnali1−/− male mice. We found that the Dnali1−/− male mice showed no significant difference in the testis weight/body weight ratio when compared to WT male mice (Fig. 2A and B). Hematoxylin and Eosin (H&E) staining using sperm from cauda epididymides showed no obvious morphology difference between WT and Dnali1−/− groups (Fig. 2C). Through the computer-assisted sperm analysis (CASA) system, we found that Dnali1−/− male mice presented significantly decreased sperm motility compared to WT male mice (Fig. 2D-F). Together, these results suggest that Dnali1 is required for normal sperm motility.
Dnali1 deficiency disrupts the ultrastructure of sperm flagella
We next explored whether abnormalities occur in spermatogenesis. By immunofluorescence staining of testis sections from WT male mice, we observed that DNALI1 is abundant in spermatocytes, round spermatids, elongating spermatids, and late spermatids (Fig. 3A); while in Dnali1−/− testes, no DNALI1 signal was detected in these cell types (Fig. 3B). H&E staining of sections from the testis and cauda epididymis revealed no obvious abnormalities in the sperm cells within the testicular seminiferous tubules or cauda epididymides in Dnali1−/− male mice when compared to WT controls (Fig. 3C). Consistently, no obvious abnormalities in spermatogonia, spermatocytes, round spermatids, or elongating spermatids were observed in testicular cross-sections by Periodic acid-Schiff (PAS) staining analysis (Fig. 3D).
We further used transmission electron microscopy (TEM) to analyze sperm flagellar ultrastructure in sperm from WT and Dnali1−/− male mice. The result showed that the midpiece and the principal piece of Dnali1−/− flagella displayed the typical “9 + 2” microtubular structures (with visible IDAs) similar with WT controls, and peri-axonemal structures, such as ODFs and MS, were present (Fig. 3E). Immunofluorescence analysis on WT and Dnali1−/− sperm showed the presence of DNAH2 (an IDA protein) in Dnali1−/− sperm (Fig. S5). Intriguingly, we found that the third and eighth ODFs in the principal piece were replaced by two LCs of FSs with a symmetrical distribution in WT flagella, while the flagella of Dnali1−/− male mice displayed asymmetric LCs, displaying as two abnormal “protruding horns” (Fig. 3E). Together, these results suggest that DNALI1 exerts functions in sperm flagellum assembly.
Dnali1-associated male infertility could be overcome by intracytoplasmic sperm injection
To explore the effect of Dnali1 deficiency on the ability of sperm in reaching oocytes for fertilization in vivo, WT female mice were superovulated and respectively mated with WT or Dnali1−/− male mice; embryos were harvested from female mice at the zygote stage and cultured in vitro to the blastocyst stage. A high rate of blastocysts was obtained in the WT group (77%), while no blastocysts were obtained for the Dnali1−/− group (0%), indicating a failure of Dnali1−/− sperm in reaching oocytes for fertilization in vivo (Fig. 4A and B).
To examine whether the male infertility caused by Dnali1 deficiency could be overcome, we performed intracytoplasmic sperm injection (ICSI) using the sperm from WT and Dnali1−/− male mice, and two-cell embryos were transferred into foster female mice. As a result, offspring were successfully obtained from Dnali1−/− male mice; genotyping of the gDNA showed that the ICSI offspring of WT male mice were wild-type, and the ICSI offspring of Dnali1−/− male mice were heterozygous (Fig. 4C-E). These results provide experimental evidence that male infertility caused by Dnali1 deficiency could be overcome by the ICSI.
Discussion
Owing to the similar spermatogenic steps and cell types between humans and mice, knockout/mutated mouse models of specific spermatogenesis-related genes are valuable tools for understanding protein functions and networks underlying male fertility, as well as for validating the genetics of human infertility [22,23,24,25]. The murine Dnali1 gene encodes a flagellar protein that interacts with the cytoplasmic dynein heavy chain 1 [12], and DNALI1 is conserved during evolution (Fig. 1). The murine and human DNALI1 proteins share 95% identical amino acids [12], indicating that the mouse is a suitable model organism for exploring the functions of DNALI1 in spermatogenesis.
Previous studies reported that the expression levels of genes related to sperm flagellum biogenesis are significantly increased 12 days post birth [26]. Consistently, we found that Dnali1 is abundant in the testis, and starts to express from postnatal day 15 (Fig. 1). By generating a mutated mouse model, we found that Dnali1−/− male mice are sterile with significantly reduced sperm motility and with ultrastructural defects in the sperm flagellum (Figs. 2 and 3). The sperm flagellum is an evolutionary conserved organelle which sustains sperm motility, and is indispensable for sperm progression within the female genital tract and fertilization [9]. Functional and structural defects in the sperm flagellum often result in sperm motility abnormalities, which are characterized as asthenozoospermia in humans [27]. Previous studies identified two infertile men with asthenozoospermia harboring pathogenic mutations in DNALI1 [14, 15]. Semen parameter analysis of the two DNALI1-mutated men showed significantly decreased sperm motility [14, 15]. Consistent with these phenotypes, our Dnali1−/− male mice showed male infertility and asthenozoospermia (Fig. 1F, 2E, and F). Abnormal LC localization was observed by TEM analysis in the DNALI1-mutated man [15]. In Dnali1−/− male mice, we observed ultrastructural abnormalities in the sperm flagellum, displaying as asymmetric LCs, indicating that the process of flagellum assembly was affected due to the Dnali1 deficiency (Fig. 3).
During the draft preparation of this study, an independent study using a Dnali1 conditional knockout (cKO) mouse model reported that DNALI1 interacts with the MEIG1/PACRG complex in the manchette, and is involved in intra-manchette transport (IMT), intra-flagellar transport (IFT) and sperm motility in mice [16]. It’s worth noting that both the reported Dnali1 cKO male mice and our Dnali1−/− mice display male infertility, damaged sperm motility, and disorganized fibrous sheath structure (Figs. 1F, 2E, F, 3E) [16]; these phenotypes recapitulate the reported phenotypes of the DNALI1-mutated infertile man [15]. The Dnali1 cKO mice showed more severe phenotypes in terms of sperm counts and sperm gross morphology compared to our Dnali1−/− mice, possibly owing to the different strategies used for constructing mutant mice. In addition to reproductive phenotypes, hydrocephalus was also observed in some Dnali1−/− mice, indicating that DNALI1 may also function in motile cilia in the brain (Fig. S3).
Together, these studies collectively demonstrated Dnali1 is indispensable for sperm motility. More importantly, our analysis of ICSI on Dnali1-mutated male mice achieved a good prognosis (Fig. 4). This finding is consistent with recent studies reporting good prognosis by ICSI using sperm from DNALI1-mutated men [14, 15]. Collectively, these studies establish that ICSI is recommended as a suitable strategy for overcoming male infertility caused by DNALI1/Dnali1 deficiency. In addition, the consistent infertility phenotypes caused by DNALI1/Dnali1 deficiency, and the consistent ICSI outcomes between Dnali1-mutated mice and DNALI1-mutated men, are in line with the notion that the mutant mouse model is a useful reference for analyzing the genetics of human infertility [22,23,24,25, 28, 29].
Limitations of the study
This study does not recruit infertile men with asthenozoospermia to screen for potential mutations in human DNALI1 gene. Future studies screening infertile men for mutations in DNALI1 will provide more insights into the contribution of DNALI1 deficiency to human infertility. Besides, how DNALI1 functions to facilitate the proper localization of LCs during sperm flagellum assembly needs a follow-up study.
Conclusions
In summary, we generated a Dnali1-mutated mouse model and showed that Dnali1 plays an important role in mouse spermatogenesis. Dnali1 deficiency induced damaged sperm motility, and caused complete male infertility. In addition, Dnali1 deficiency results in asymmetric LCs in the principal piece of sperm flagella. Finally, we show ICSI is an effective approach to overcome Dnali1-associated male infertility. Our study demonstrated a role of Dnali1 in sperm flagellum assembly, sperm motility, and male fertility.
Availability of data and materials
Data needed to evaluate the conclusions are present in the paper and the Supplementary Materials. Newly generated mutant mouse model can be provided by the corresponding author pending scientific review and a completed material transfer agreement.
Abbreviations
- CASA:
-
Computer-assisted sperm analysis
- FS:
-
Fibrous sheath
- H&E:
-
Hematoxylin and Eosin
- IDA:
-
Inner dynein arm
- ICSI:
-
Intracytoplasmic sperm injection
- IMT:
-
Intra-manchette transport
- IFT:
-
Intra-flagellar transport
- LCs:
-
Longitudinal columns
- MTD:
-
Microtubule doublets
- MS:
-
Mitochondrial sheath
- ODA:
-
Outer dynein arm
- ODF:
-
Outer dense fiber
- qPCR:
-
Real-time quantitative PCR
- WT:
-
Wild-type
References
Lehti MS, Sironen A. Formation and function of sperm tail structures in association with sperm motility defects. Biol Reprod. 2017;97(4):522–36. https://doi.org/10.1093/biolre/iox096.
Sironen A, Shoemark A, Patel M, Loebinger MR, Mitchison HM. Sperm defects in primary ciliary dyskinesia and related causes of male infertility. Cell Mol Life Sci. 2020;77(11):2029–48. https://doi.org/10.1007/s00018-019-03389-7.
Pereira R, Oliveira ME, Santos R, Oliveira E, Barbosa T, Santos T, et al. Characterization of CCDC103 expression profiles: further insights in primary ciliary dyskinesia and in human reproduction. J Assist Reprod Genet. 2019;36(8):1683–700. https://doi.org/10.1007/s10815-019-01509-7.
Heuser T, Raytchev M, Krell J, Porter ME, Nicastro D. The dynein regulatory complex is the nexin link and a major regulatory node in cilia and flagella. J Cell Biol. 2009;187(6):921–33. https://doi.org/10.1083/jcb.200908067.
Gui M, Ma M, Sze-Tu E, Wang X, Koh F, Zhong ED, et al. Structures of radial spokes and associated complexes important for ciliary motility. Nat Struct Mol Biol. 2021;28(1):29–37. https://doi.org/10.1038/s41594-020-00530-0.
Kobayashi D, Takeda H. Ciliary motility: the components and cytoplasmic preassembly mechanisms of the axonemal dyneins. Differentiation. 2012;83(2):S23–9. https://doi.org/10.1016/j.diff.2011.11.009.
Roberts AJ, Malkova B, Walker ML, Sakakibara H, Numata N, Kon T, et al. ATP-driven remodeling of the linker domain in the dynein motor. Structure. 2012;20(10):1670–80. https://doi.org/10.1016/j.str.2012.07.003.
Eddy EM, Toshimori K, O’Brien DA. Fibrous sheath of mammalian spermatozoa. Microsc Res Tech. 2003;61(1):103–15. https://doi.org/10.1002/jemt.10320.
Toure A, Martinez G, Kherraf ZE, Cazin C, Beurois J, Arnoult C, et al. The genetic architecture of morphological abnormalities of the sperm tail. Hum Genet. 2021;140(1):21–42. https://doi.org/10.1007/s00439-020-02113-x.
Pereira R, Sousa M. Morphological and Molecular Bases of Male Infertility: A Closer Look at Sperm Flagellum. Genes (Basel). 2023;14(2). https://doi.org/10.3390/genes14020383.
Zhao W, Li Z, Ping P, Wang G, Yuan X, Sun F. Outer dense fibers stabilize the axoneme to maintain sperm motility. J Cell Mol Med. 2018;22(3):1755–68. https://doi.org/10.1111/jcmm.13457.
Rashid S, Breckle R, Hupe M, Geisler S, Doerwald N, Neesen J. The murine Dnali1 gene encodes a flagellar protein that interacts with the cytoplasmic dynein heavy chain 1. Mol Reprod Dev. 2006;73(6):784–94. https://doi.org/10.1002/mrd.20475.
Subramanian A, Kabi A, Gray SF, Pennock D. p28 dynein light chains and ciliary motility in Tetrahymena thermophila. Cytoskeleton (Hoboken). 2016;73(4):197–208. https://doi.org/10.1002/cm.21295.
Sha Y, Liu W, Nie H, Han L, Ma C, Zhang X, et al. Homozygous mutation in DNALI1 leads to asthenoteratozoospermia by affecting the inner dynein arms. Front Endocrinol (Lausanne). 2022;13:1058651. https://doi.org/10.3389/fendo.2022.1058651.
Wu H, Liu Y, Li Y, Li K, Xu C, Gao Y, et al. DNALI1 deficiency causes male infertility with severe asthenozoospermia in humans and mice by disrupting the assembly of the flagellar inner dynein arms and fibrous sheath. Cell Death Dis. 2023;14(2):127. https://doi.org/10.1038/s41419-023-05653-y.
Yap YT, Li W, Huang Q, Zhou Q, Zhang D, Sheng Y, et al. DNALI1 interacts with the MEIG1/PACRG complex within the manchette and is required for proper sperm flagellum assembly in mice. Elife. 2023;12. https://doi.org/10.7554/eLife.79620.
Wang Y, Chen J, Huang X, Wu B, Dai P, Zhang F, et al. Gene-knockout by iSTOP enables rapid reproductive disease modeling and phenotyping in germ cells of the founder generation. Sci CHINA Life Sci. 2023;https://doi.org/10.1007/s11427-023-2408-2.
Wang L, Li MY, Qu C, Miao WY, Yin Q, Liao J, et al. CRISPR-Cas9-mediated genome editing in one blastomere of two-cell embryos reveals a novel Tet3 function in regulating neocortical development. Cell Res. 2017;27(6):815–29. https://doi.org/10.1038/cr.2017.58.
Cong J, Yang Y, Wang X, Shen Y, Qi HT, Liu C, et al. Deficiency of X-linked TENT5D causes male infertility by disrupting the mRNA stability during spermatogenesis. Cell Discov. 2022;8(1):23. https://doi.org/10.1038/s41421-021-00369-9.
Liu C, Tu C, Wang L, Wu H, Houston BJ, Mastrorosa FK, et al. Deleterious variants in X-linked CFAP47 induce asthenoteratozoospermia and primary male infertility. Am J Hum Genet. 2021;108(2):309–23. https://doi.org/10.1016/j.ajhg.2021.01.002.
Liu C, He X, Liu W, Yang S, Wang L, Li W, et al. Bi-allelic Mutations in TTC29 Cause Male Subfertility with Asthenoteratospermia in Humans and Mice. Am J Hum Genet. 2019;105(6):1168–81. https://doi.org/10.1016/j.ajhg.2019.10.010.
Jiao SY, Yang YH, Chen SR. Molecular genetics of infertility: loss-of-function mutations in humans and corresponding knockout/mutated mice. Hum Reprod Update. 2021;27(1):154–89. https://doi.org/10.1093/humupd/dmaa034.
Ding X, Schimenti JC. Strategies to Identify Genetic Variants Causing Infertility. Trends Mol Med. 2021;27(8):792–806. https://doi.org/10.1016/j.molmed.2020.12.008.
Houston BJ, Conrad DF, O’Bryan MK. A framework for high-resolution phenotyping of candidate male infertility mutants: from human to mouse. Hum Genet. 2021;140(1):155–82. https://doi.org/10.1007/s00439-020-02159-x.
Abbasi F, Miyata H, Ikawa M. Revolutionizing male fertility factor research in mice by using the genome editing tool CRISPR/Cas9. Reprod Med Biol. 2018;17(1):3–10. https://doi.org/10.1002/rmb2.12067.
Horowitz E, Zhang Z, Jones BH, Moss SB, Ho C, Wood JR, et al. Patterns of expression of sperm flagellar genes: early expression of genes encoding axonemal proteins during the spermatogenic cycle and shared features of promoters of genes encoding central apparatus proteins. Mol Hum Reprod. 2005;11(4):307–17. https://doi.org/10.1093/molehr/gah163.
Tu C, Wang W, Hu T, Lu G, Lin G, Tan YQ. Genetic underpinnings of asthenozoospermia. Best Pract Res Clin Endocrinol Metab. 2020;34(6):101472. https://doi.org/10.1016/j.beem.2020.101472.
Zhang Y, Huang X, Xu Q, Yu M, Shu M, Shan S, et al. Homozygous nonsense variants of KCTD19 cause male infertility in humans and mice. J Genet Genomics. 2023. https://doi.org/10.1016/j.jgg.2023.05.008.
Chen J, Wang Y, Wu B, Shi H, Wang L. Experimental and molecular support for Cfap70 as a causative gene of multiple morphological abnormalities of the flagella with male infertility. Biol Reprod. 2023. https://doi.org/10.1093/biolre/ioad076.
Acknowledgements
We thank Li Wang and Dandan Song in the Center of Cryo-Electron Microscopy (CCEM), Zhejiang University for their technical assistance on Transmission Electron Microscopy (TEM). We thank the Imaging Core Facility of State Key Laboratory of Genetic Engineering for technical support on fluorescent imaging, and the Facility of IMIB at Fudan University for technical support on imaging. We thank Professor Qinghua Shi (University of Science and Technology of China) for sharing the anti-DNAH17 antibody (a gift to Dr. Chunyu Liu). We thank Hua Diao (Shanghai Institute for Biomedical and Pharmaceutical Technologies) for his technical support on computer-assisted sperm analysis.
Funding
This study was supported by the National Key Research and Development Program of China (2021YFC2701400) and the National Natural Science Foundation of China (32000393 and 32288101).
Author information
Authors and Affiliations
Contributions
Supervision: L.W., and F.Z.; Conceptualization: L.W.; Methodology and interpretation: L.W., F.Z., and Y.W.; Investigation: Y.W., L.W., Y.Z., J.C., C.L., S.T., and B.W.; Visualization: Y.W., L.W., and Y.Z.; Writing-draft: Y.Z., and Y.W.; Writing-editing: L.W., Y.W., Y.Z., F.Z., and C.L.; Discussion: all the authors.
Corresponding authors
Ethics declarations
Competing interests
The authors declare no conflict of interest.
Additional information
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Information
Additional file 1: Figure S1.
Expression analysis of Dnali1 mRNA in the testes from Dnali1+/+ and Dnali1-/- male mice. Figure S2. Immunoblotting analysis of DNALI1 protein levels in the indicated tissues of Dnali1+/+ and Dnali1-/- mice. Figure S3. Hydrocephalus occurs in Dnali1-/- mice. Figure S4. H&E staining analysis of the trachea, lung, and oviduct sections in Dnali1+/+ and Dnali1-/- mice. Figure S5. Immunofluorescence analysis of DNAH2 and DNAH17 in the sperm of Dnali1+/+ and Dnali1-/- mice. Table S1. Primers for gene editing, genotyping, and gene expression analysis.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
About this article
Cite this article
Zhou, Y., Wang, Y., Chen, J. et al. Dnali1 is required for sperm motility and male fertility in mice. Basic Clin. Androl. 33, 32 (2023). https://doi.org/10.1186/s12610-023-00205-y
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/s12610-023-00205-y